ID: 909882867

View in Genome Browser
Species Human (GRCh38)
Location 1:80902231-80902253
Sequence CAGGAGGCTTAGAATTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909882860_909882867 23 Left 909882860 1:80902185-80902207 CCTAAGGATCTTAAGTAAGTTTA No data
Right 909882867 1:80902231-80902253 CAGGAGGCTTAGAATTAGCAAGG No data
909882864_909882867 -10 Left 909882864 1:80902218-80902240 CCAGGAAAACTCCCAGGAGGCTT No data
Right 909882867 1:80902231-80902253 CAGGAGGCTTAGAATTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909882867 Original CRISPR CAGGAGGCTTAGAATTAGCA AGG Intergenic
No off target data available for this crispr