ID: 909883118

View in Genome Browser
Species Human (GRCh38)
Location 1:80905187-80905209
Sequence CAGTGGATAAAGAGAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909883114_909883118 10 Left 909883114 1:80905154-80905176 CCAATGTTAAAAAAAAATGGAGA No data
Right 909883118 1:80905187-80905209 CAGTGGATAAAGAGAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909883118 Original CRISPR CAGTGGATAAAGAGAGTGGA AGG Intergenic
No off target data available for this crispr