ID: 909887558

View in Genome Browser
Species Human (GRCh38)
Location 1:80961898-80961920
Sequence ATTCACTGCACCTGGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909887558_909887562 17 Left 909887558 1:80961898-80961920 CCTGCAGCCCAGGTGCAGTGAAT No data
Right 909887562 1:80961938-80961960 TTCAGCTGCCAACTCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909887558 Original CRISPR ATTCACTGCACCTGGGCTGC AGG (reversed) Intergenic
No off target data available for this crispr