ID: 909887903

View in Genome Browser
Species Human (GRCh38)
Location 1:80965450-80965472
Sequence CCTAAGAAACAGTGGTAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909887897_909887903 29 Left 909887897 1:80965398-80965420 CCACTGCCTTTTGCTGTAATAAT No data
Right 909887903 1:80965450-80965472 CCTAAGAAACAGTGGTAAATAGG No data
909887899_909887903 -1 Left 909887899 1:80965428-80965450 CCTTAGAAACCTGTCAATGTAAC No data
Right 909887903 1:80965450-80965472 CCTAAGAAACAGTGGTAAATAGG No data
909887900_909887903 -10 Left 909887900 1:80965437-80965459 CCTGTCAATGTAACCTAAGAAAC No data
Right 909887903 1:80965450-80965472 CCTAAGAAACAGTGGTAAATAGG No data
909887898_909887903 23 Left 909887898 1:80965404-80965426 CCTTTTGCTGTAATAATGATTAA No data
Right 909887903 1:80965450-80965472 CCTAAGAAACAGTGGTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909887903 Original CRISPR CCTAAGAAACAGTGGTAAAT AGG Intergenic
No off target data available for this crispr