ID: 909891905

View in Genome Browser
Species Human (GRCh38)
Location 1:81017767-81017789
Sequence GTTATTTTATTCAGAAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909891905_909891911 21 Left 909891905 1:81017767-81017789 CCCTTTTTTCTGAATAAAATAAC No data
Right 909891911 1:81017811-81017833 GAACATGGACATACCTTTTGGGG No data
909891905_909891909 19 Left 909891905 1:81017767-81017789 CCCTTTTTTCTGAATAAAATAAC No data
Right 909891909 1:81017809-81017831 TAGAACATGGACATACCTTTTGG No data
909891905_909891910 20 Left 909891905 1:81017767-81017789 CCCTTTTTTCTGAATAAAATAAC No data
Right 909891910 1:81017810-81017832 AGAACATGGACATACCTTTTGGG No data
909891905_909891907 6 Left 909891905 1:81017767-81017789 CCCTTTTTTCTGAATAAAATAAC No data
Right 909891907 1:81017796-81017818 AGATTCCAGAAATTAGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909891905 Original CRISPR GTTATTTTATTCAGAAAAAA GGG (reversed) Intergenic
No off target data available for this crispr