ID: 909894529

View in Genome Browser
Species Human (GRCh38)
Location 1:81050706-81050728
Sequence ATTTTTTTCGGGGGCATCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909894529_909894535 13 Left 909894529 1:81050706-81050728 CCTGTGATGCCCCCGAAAAAAAT No data
Right 909894535 1:81050742-81050764 TTCTCTCTTCATTCACACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909894529 Original CRISPR ATTTTTTTCGGGGGCATCAC AGG (reversed) Intergenic
No off target data available for this crispr