ID: 909907795

View in Genome Browser
Species Human (GRCh38)
Location 1:81220951-81220973
Sequence GCCTCTCGGCACCAACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909907790_909907795 17 Left 909907790 1:81220911-81220933 CCAGGGGTGGCTGAGGGTGGCTT No data
Right 909907795 1:81220951-81220973 GCCTCTCGGCACCAACAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909907795 Original CRISPR GCCTCTCGGCACCAACAGCC TGG Intergenic
No off target data available for this crispr