ID: 909922209

View in Genome Browser
Species Human (GRCh38)
Location 1:81396241-81396263
Sequence GGTAATGATTTTGTAGCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909922205_909922209 1 Left 909922205 1:81396217-81396239 CCTCTTTGGTTAAATGTATTCCC 0: 1
1: 15
2: 227
3: 916
4: 2108
Right 909922209 1:81396241-81396263 GGTAATGATTTTGTAGCTATTGG 0: 1
1: 0
2: 0
3: 13
4: 190
909922203_909922209 19 Left 909922203 1:81396199-81396221 CCTTGTAGAGATCTTTTACCTCT 0: 18
1: 163
2: 803
3: 1642
4: 2017
Right 909922209 1:81396241-81396263 GGTAATGATTTTGTAGCTATTGG 0: 1
1: 0
2: 0
3: 13
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909922209 Original CRISPR GGTAATGATTTTGTAGCTAT TGG Intronic
901348811 1:8573209-8573231 GATAATGTTTTTGTTGCTTTAGG - Intronic
905532356 1:38691367-38691389 GGTAATGATTTTTTAAAAATAGG + Intergenic
906487966 1:46246420-46246442 GCTAATTTTTTTGTAGATATGGG + Intergenic
909922209 1:81396241-81396263 GGTAATGATTTTGTAGCTATTGG + Intronic
912596931 1:110888237-110888259 GGTAATGTTTTAGCAGCAATAGG + Intronic
914862117 1:151395448-151395470 TTTAATGTTTTTGTAGATATAGG + Intergenic
916811548 1:168309772-168309794 AGTAGTGATTTTGTGGCTTTGGG + Intronic
917590986 1:176476780-176476802 GGTTATGATTCTGTATGTATAGG + Intronic
917740662 1:177959109-177959131 GGTAATGAGTCTATAGCTATAGG + Intronic
918784694 1:188750419-188750441 GGAAATTATTTTGGAGCTTTAGG + Intergenic
918810296 1:189109937-189109959 TGTAAAAATTTTGAAGCTATTGG + Intergenic
919648810 1:200124765-200124787 GCTAATTATTTTGTAGAGATGGG - Intronic
921528729 1:216252773-216252795 AGTAATGATTTTGTATCCTTTGG - Intronic
922644393 1:227271819-227271841 TGTAATGAGATTGTTGCTATGGG - Intronic
924093316 1:240524866-240524888 GATAATGATGTTGAAGCAATGGG + Intronic
1067680299 10:48431353-48431375 AATAATGATTTTGTAAATATGGG - Intronic
1068395839 10:56460311-56460333 TGTAATGTTTCTGTAACTATAGG + Intergenic
1069186795 10:65433224-65433246 GATAATCATTTTTGAGCTATGGG + Intergenic
1071187481 10:83060950-83060972 GGAAATGATTTAGGATCTATGGG - Intergenic
1072135565 10:92542459-92542481 GGTAATTTTTTTGTAGAGATGGG + Intronic
1072466420 10:95666683-95666705 GGGAATGATTTTTCAGCTATGGG + Intronic
1072704138 10:97667941-97667963 GGTTATAATTTTGTTGTTATAGG + Intronic
1077760289 11:5087956-5087978 GTTAATCATTTTGTGGATATGGG + Intergenic
1079828399 11:25229604-25229626 GATATTGATTCTGTAGATATGGG + Intergenic
1082231021 11:49766355-49766377 AGTATTGATATTGTATCTATAGG - Intergenic
1082301986 11:50517684-50517706 GATATTCATTTTTTAGCTATTGG + Intergenic
1082660469 11:55903608-55903630 GGTAATTATGATGTAGCTGTAGG + Intergenic
1086550893 11:88050384-88050406 GATAAGGATCTTGTAGCTTTAGG - Intergenic
1088671267 11:112143817-112143839 GGTAATGTTTTTTTCTCTATAGG - Exonic
1090504709 11:127298532-127298554 GGAGATCATTTTGTAGCTTTAGG + Intergenic
1091130173 11:133139653-133139675 GCTGATGATTTAGGAGCTATGGG + Intronic
1091736477 12:2926326-2926348 GGTAATTTTTTTGTAGAGATGGG - Intronic
1097609267 12:61798233-61798255 AGAAATGATTTTGTAATTATAGG - Intronic
1098125018 12:67281991-67282013 GAAAATGATTTTGAAGTTATTGG + Exonic
1098826124 12:75299285-75299307 GATAATAAATTTGTATCTATGGG - Intronic
1099123132 12:78718040-78718062 TGTAGTGATTTTGTAAATATAGG - Intergenic
1099718132 12:86323840-86323862 GGCAAAGATTTAGTAGCTTTAGG - Intronic
1099929270 12:89054658-89054680 GTTAATAATTTTGAAGCTCTGGG + Intergenic
1100164418 12:91900420-91900442 GGAAATGATTTTGGAGCATTTGG + Intergenic
1107633335 13:42365021-42365043 TTTCATGATTTTGTTGCTATTGG + Intergenic
1108632202 13:52296001-52296023 GGGAATGATTATGATGCTATTGG - Intergenic
1108654500 13:52516593-52516615 GGGAATGATTATGATGCTATTGG + Intergenic
1108774872 13:53753488-53753510 CTTAATGATTCTGTAGCTTTGGG - Intergenic
1109128044 13:58543261-58543283 TGTAATGATTGTTTAGATATTGG + Intergenic
1109449417 13:62490662-62490684 GCTCATGATTCTGTAGCTACAGG + Intergenic
1109580440 13:64324965-64324987 TGTAAGGATTTTATAGCTAAAGG - Intergenic
1110170839 13:72498710-72498732 GGAAATGATGATTTAGCTATAGG + Intergenic
1110922699 13:81108637-81108659 GGTAAGGAGTTTGTAGATGTGGG - Intergenic
1111547840 13:89767092-89767114 GCTAATGATGTTGTATGTATAGG + Intergenic
1112167354 13:96933771-96933793 GGTAATGGATTAGTAACTATGGG + Intergenic
1112259241 13:97863419-97863441 GGAGATCATTTTGGAGCTATAGG - Intergenic
1114253402 14:20980959-20980981 AGTAATTTTTTTGTAGATATGGG - Intergenic
1115130947 14:30051181-30051203 GGTCATGGTTTTTTACCTATTGG - Intronic
1115455768 14:33600622-33600644 AGTAATTATTTTATAACTATGGG - Intronic
1116638468 14:47429409-47429431 GGTAATGGTTTTGTATCTTCTGG + Intronic
1117305409 14:54468929-54468951 GATTAAGATTTTGGAGCTATCGG + Intergenic
1118293612 14:64548734-64548756 GGTAATGATTATGTAGTGATTGG + Intergenic
1118339750 14:64884616-64884638 AATAATGATTTTTGAGCTATGGG - Intergenic
1119008451 14:70957158-70957180 GGTAATGTTTTTGTAGAGATGGG + Intronic
1119136469 14:72225498-72225520 GGTATTAATTTTGTAGAAATGGG + Intronic
1119149066 14:72341703-72341725 GGCATTTATTTTGTAGCTGTGGG + Intronic
1120110069 14:80543686-80543708 GGGAAGGACTTTCTAGCTATTGG - Intronic
1123952873 15:25300095-25300117 TTTAATTTTTTTGTAGCTATAGG - Intergenic
1129914871 15:79260062-79260084 GGGAATGATTTTGTAGCCCAAGG + Intergenic
1131214863 15:90529014-90529036 GTAAATGTTTTTGTAGCAATGGG - Intergenic
1132692906 16:1189591-1189613 GTTAAATATTTTGTAGCAATGGG + Intronic
1133316490 16:4887765-4887787 GCTAATATTTTTGTAGATATGGG + Intronic
1133909030 16:10048127-10048149 TGTATTAATTTTGTAGCCATGGG + Intronic
1136604273 16:31322282-31322304 GGTAATCATTTTTTAGGGATGGG - Intronic
1139452934 16:67046269-67046291 GGTAATTTTTTTGTAGATATGGG + Intronic
1140192069 16:72826294-72826316 GCTACTGATTTTGTAGTTTTGGG - Intronic
1145841054 17:27994999-27995021 GGTTAAGATTTTGTAGCACTAGG - Intergenic
1146385866 17:32372601-32372623 GTTCCTGAGTTTGTAGCTATAGG + Exonic
1147136539 17:38437294-38437316 GCTAATTTTTTTGTAGCGATGGG + Intronic
1147452221 17:40512707-40512729 GATAATGATTTGTCAGCTATGGG + Intergenic
1147517836 17:41138950-41138972 GGTAATTATTTTGTTGTTAATGG + Intergenic
1150414196 17:64974185-64974207 GCTAATTTTTTTGTAGATATGGG - Intergenic
1150797442 17:68249468-68249490 GCTAATTTTTTTGTAGATATGGG + Intronic
1150870724 17:68907928-68907950 GTTAATTATTTTCTTGCTATTGG - Intronic
1150922846 17:69501472-69501494 GGTAAATATTTTCTAACTATTGG + Intronic
1154942085 18:21124262-21124284 GGATATGATTGTGTACCTATGGG - Intergenic
1158267132 18:55672069-55672091 AGTAATTATTTTGTAGCACTAGG + Intergenic
1158797707 18:60867804-60867826 GGTAGTCATTTGGTAGCTACAGG + Intergenic
1159278754 18:66256040-66256062 TTTAATTATTTTGTTGCTATTGG - Intergenic
1159932585 18:74329215-74329237 GCTAATAATTTTGTAGAGATGGG - Intronic
925519317 2:4723968-4723990 GCTTTTGACTTTGTAGCTATAGG - Intergenic
925636313 2:5944453-5944475 GTTTCTGATTTTGTAGCTTTTGG + Intergenic
926534334 2:14092335-14092357 GCTAATTTTTTTGTAGCCATGGG - Intergenic
926918328 2:17914861-17914883 GGCACTGATTTTGTAGTTTTTGG + Intronic
926976559 2:18521747-18521769 GGTAATGAAAATGTAGTTATGGG + Intergenic
929344709 2:40867218-40867240 GGTAGGGATTCTGTAGCTATTGG - Intergenic
929631919 2:43471807-43471829 TGTAATGATTTTGTGCCTGTTGG + Intronic
930158752 2:48131526-48131548 GGGTATGATTTTGTAAGTATTGG + Intergenic
930567015 2:53033707-53033729 GGAAATGATTTTGTAGAAATAGG - Intergenic
931876923 2:66523908-66523930 GGTAATGAATTTTTAGAAATAGG - Intronic
940482417 2:154251880-154251902 GTTAATCATTTTGTAGGTTTAGG - Intronic
940822593 2:158373385-158373407 GGTAATGTTTTTTCAGCAATAGG + Intronic
942012922 2:171781867-171781889 GGTAATTTTTTTGCTGCTATAGG - Intergenic
942334231 2:174864697-174864719 GCTAATTTTTTTGTAGCGATGGG - Intronic
942503221 2:176614213-176614235 GGAAATGATTCTGAAGCCATAGG - Intergenic
1170279484 20:14629586-14629608 TGTAATGATTGTGAAGCTGTAGG + Intronic
1173262584 20:41450149-41450171 CTTAATGATTTTGTAGTTGTTGG - Intronic
1173588378 20:44203257-44203279 GCTTATGATTTTGCAGCCATGGG - Intronic
1174475026 20:50790585-50790607 GGCAGTCATTTTGTAGCTAGAGG + Intergenic
1175019854 20:55834147-55834169 TGTAATGATCTTGTACTTATTGG - Intergenic
1177211519 21:18077400-18077422 AGTTAAGATTTTGGAGCTATTGG + Intronic
1177305274 21:19307017-19307039 GGAACTGATTTTGTAGCATTTGG - Intergenic
1178138895 21:29659599-29659621 AGTAATTATTTTTTAGCTACTGG - Intronic
1180721213 22:17910181-17910203 GGGAAGGATTTTGGAGTTATGGG - Intronic
1182643681 22:31790087-31790109 GGTGCTGATTTTGGAGCTCTTGG + Intronic
1184312967 22:43660272-43660294 GGAAATGATTTTGTTGCTTTGGG - Intronic
1203239350 22_KI270733v1_random:142-164 GCTGGTGACTTTGTAGCTATGGG - Intergenic
950983745 3:17337444-17337466 GACAATGATTTTGGAGCTATAGG - Intronic
951341413 3:21492258-21492280 GCTATTGATTTTTAAGCTATTGG - Intronic
951594624 3:24304105-24304127 GGAAATGATTTTGAAACTTTTGG + Intronic
957649860 3:82986327-82986349 GGGAATGATTTTGTAAGTAAAGG - Intergenic
957821388 3:85379142-85379164 GGTAATATTTTTGTTGCTTTTGG - Intronic
958118735 3:89256850-89256872 GGTAATGAATCTGAATCTATAGG + Intronic
959352631 3:105286001-105286023 GGTAATTATTTTCCAGGTATTGG + Intergenic
962753929 3:138454082-138454104 TTTAATGTTTTTGTAGCGATAGG - Intronic
964632106 3:158822269-158822291 AATAATTATTTTGTAGATATTGG - Intronic
965294275 3:166923849-166923871 GGTGATTATATTGTAGCTTTAGG - Intergenic
967242126 3:187449935-187449957 TGTATTTATTTTGTATCTATAGG + Intergenic
967423716 3:189302165-189302187 CCTAATGATTTTATAACTATGGG - Intronic
967661944 3:192123029-192123051 GGTAATGTCATGGTAGCTATTGG - Intergenic
969290603 4:6236840-6236862 GCTAATTATTTTGTAGAGATGGG + Intergenic
969378281 4:6777664-6777686 GGAAATGATTATTTAGTTATAGG - Intergenic
970087760 4:12367393-12367415 GGAAATGATTTAGGATCTATGGG - Intergenic
970124137 4:12790352-12790374 AGTAATCCTTTGGTAGCTATTGG + Intergenic
970548731 4:17157089-17157111 GGTAATTATTTTATATCTATAGG - Intergenic
970918244 4:21361702-21361724 GGAATTGATTTAGTTGCTATGGG - Intronic
971618651 4:28827203-28827225 GGTAATGATTTTGTTTCCTTTGG - Intergenic
972890092 4:43547401-43547423 TTTAATGATATTGAAGCTATTGG - Intergenic
977153612 4:93545351-93545373 GGATAAGATTTAGTAGCTATGGG + Intronic
978022972 4:103836461-103836483 GGAAATGATTTTGAAAGTATAGG - Intergenic
981569742 4:146138816-146138838 GGTCATCATTTTGTAGGCATTGG - Intergenic
983448241 4:167879736-167879758 GGAAAGGATTTAGTATCTATGGG - Intergenic
983563779 4:169128462-169128484 GCTAATAATGTTGTAGCTAGAGG - Intronic
984466609 4:180107526-180107548 GGTAATGATTTTGTATCCCAGGG + Intergenic
986068300 5:4257238-4257260 GTTAATCATTTTGTGTCTATTGG + Intergenic
987478538 5:18423080-18423102 GGTACTGATTTTCTAGCTGATGG - Intergenic
989462484 5:41716577-41716599 AGTAATGATTATGTAGCTCAAGG + Intergenic
992481454 5:77156217-77156239 GATAATGTTCATGTAGCTATGGG + Intergenic
992681417 5:79157081-79157103 GGAACTGAGTTAGTAGCTATGGG - Intronic
994100656 5:95888539-95888561 AGAAATGATTTTTTAGATATTGG - Exonic
997677895 5:135727902-135727924 GCAAATTATTTTGTAGATATAGG - Intergenic
1000327649 5:160184454-160184476 GCTAATTTTTTTGTAGCGATGGG + Intergenic
1000979858 5:167805109-167805131 GGTCATGATTATGTAGCAATTGG + Intronic
1002182767 5:177440058-177440080 GGTAATGATGTTTAAGCTTTTGG + Intronic
1004594148 6:17082994-17083016 GTTAATGTTTTTGTAGAGATGGG - Intergenic
1007527666 6:42510940-42510962 GGTAAGGATTCTGTATTTATAGG + Intergenic
1008967267 6:57325463-57325485 GCTAATTTTTTTGTAGATATGGG + Intronic
1009893254 6:69714926-69714948 GGATATGATTTTGTAGGTCTTGG + Intronic
1010099076 6:72081293-72081315 TCTATTGATTTTGTAGCAATTGG - Intronic
1010697728 6:78997829-78997851 AGTAATGATTTTGTATCCTTGGG - Intronic
1010922587 6:81702862-81702884 ACTAATGATTTTGTTGCAATTGG - Intronic
1011038933 6:83009293-83009315 GGTAATCATTATTTACCTATTGG - Intronic
1015832252 6:137383331-137383353 TTTAATGTTTTTGTAGCGATAGG + Intergenic
1016128588 6:140436923-140436945 GGTAATAATATTGTATCTAGTGG - Intergenic
1016479533 6:144467276-144467298 GGGAACGATTATCTAGCTATGGG - Intronic
1017472307 6:154751136-154751158 TGTTATGCATTTGTAGCTATAGG + Intronic
1018475294 6:164134669-164134691 GGTAAGGACGTTGCAGCTATTGG + Intergenic
1020348542 7:7192209-7192231 GGTAATGATTTTTGAGATTTGGG + Intronic
1020909836 7:14115243-14115265 GCTTTTAATTTTGTAGCTATTGG + Intergenic
1022190590 7:28013494-28013516 GCTCCTGATTTAGTAGCTATAGG + Intronic
1022420764 7:30221136-30221158 TTTAATGTTTTTGTAGATATGGG - Intergenic
1023273320 7:38490780-38490802 GTTTATGATTTTATATCTATAGG + Intronic
1023685430 7:42729552-42729574 GCTAATGATTCAGTAGCTCTTGG - Intergenic
1024709985 7:52004635-52004657 GGTACAGTTTTTATAGCTATGGG + Intergenic
1024952888 7:54883155-54883177 GGTGATGTTTTTGTTTCTATGGG - Intergenic
1031552183 7:123128559-123128581 GGGAATAATTTTGTAGGGATGGG + Intronic
1032280443 7:130495579-130495601 GGTATTTATTTTGTGGCTATTGG + Intronic
1034914797 7:155028281-155028303 TGTAATGTTTTTGTAGAGATGGG - Intergenic
1034967940 7:155403108-155403130 AGTGAGGATTTTGTAGCCATGGG + Intergenic
1037292134 8:17362188-17362210 GATAATGATTTTGGATATATTGG - Intronic
1040795166 8:51282339-51282361 GGTAAGGAAATAGTAGCTATGGG - Intergenic
1044389713 8:91635527-91635549 GCTAAAGAAATTGTAGCTATAGG + Intergenic
1046158537 8:110328277-110328299 GGTTATAATTTGGTAGCTCTGGG + Intergenic
1047414973 8:124657115-124657137 GGTAATGGTATTGTGGTTATGGG + Intronic
1048419041 8:134258947-134258969 GGTCAGGATCTTGTAGATATTGG - Intergenic
1049176933 8:141198640-141198662 GTTAATGTTTTTATAGCGATGGG - Intergenic
1050348059 9:4713174-4713196 AATAATGATATTGTAGATATAGG + Intronic
1052738226 9:32367334-32367356 GCTAATGTTTTTGTAGAGATGGG - Intergenic
1055098107 9:72435151-72435173 GTTAATTATTTTGTGGTTATAGG + Intergenic
1056558392 9:87708720-87708742 TGTAATGATTTTCTAGGTTTTGG - Intergenic
1057159192 9:92874201-92874223 GATTCTGATTTAGTAGCTATGGG - Intronic
1058755689 9:108081033-108081055 TCTAATGATTTTGTAGTCATAGG - Intergenic
1059959450 9:119551097-119551119 GGTAATCACTTTCTAGCTTTTGG + Intergenic
1059975962 9:119717580-119717602 GGAAATGAGTTTGTATATATTGG + Intergenic
1060380186 9:123162387-123162409 GCTAATTTTTTTGTAGATATGGG + Intronic
1060836947 9:126763244-126763266 TCTCATGATTTTGTAGCTCTGGG + Intergenic
1186346686 X:8701182-8701204 GGTCATGACATTTTAGCTATTGG - Intronic
1191212148 X:57896849-57896871 GGTACTTTTTTTGTAGCTATTGG - Intergenic
1194156897 X:90401707-90401729 AGTAATGTTTTTGTAGAAATGGG - Intergenic
1194318830 X:92417326-92417348 AGTACTGATTTAGCAGCTATAGG - Intronic
1194729889 X:97440633-97440655 GGTATTGATTATGGAGATATGGG + Intronic
1194899610 X:99493905-99493927 GGCAATAATTATGTAGGTATAGG + Intergenic
1196651012 X:118168389-118168411 GGTCATGATTTTGTACTTCTGGG - Intergenic
1198945348 X:142006342-142006364 GATAATGTTTTTGCAGATATTGG - Intergenic
1199118501 X:144021666-144021688 GGCAATGATTCTGGAGATATGGG + Intergenic
1199917203 X:152356188-152356210 GATTATGATTTGGTAGCTCTGGG - Intronic
1200282617 X:154790632-154790654 TGTAATGCTTTTGTTGGTATGGG - Intronic
1200503236 Y:3978681-3978703 AGTAATGTTTTTGTAGAAATGGG - Intergenic
1200626963 Y:5530482-5530504 AGTACTGATTTAGCAGCTATAGG - Intronic