ID: 909924168

View in Genome Browser
Species Human (GRCh38)
Location 1:81419062-81419084
Sequence CAGAACTAAAGCTCAAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909924165_909924168 17 Left 909924165 1:81419022-81419044 CCAGGAATGCAATGCACTAGACT 0: 1
1: 0
2: 0
3: 8
4: 100
Right 909924168 1:81419062-81419084 CAGAACTAAAGCTCAAAAGTAGG 0: 1
1: 0
2: 1
3: 25
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909924168 Original CRISPR CAGAACTAAAGCTCAAAAGT AGG Intronic
901328164 1:8382073-8382095 CAGGACCAAAGCTCAAAAGCAGG + Intronic
901348719 1:8572082-8572104 AAGAAACAAAGCCCAAAAGTTGG - Intronic
904846449 1:33422011-33422033 CAGAAATAAGGCTGAAAAGTAGG - Intronic
905343806 1:37297852-37297874 CTGAACATCAGCTCAAAAGTTGG - Intergenic
905787247 1:40768011-40768033 CAGAACTAAAGCCAAAAAATGGG + Intronic
906634246 1:47397753-47397775 CAGAAATAGAGCTCAAACCTAGG + Intergenic
908246005 1:62228211-62228233 CCTGACTAAAGCTCAAAAGAAGG + Intergenic
908374392 1:63519952-63519974 CTGAACTAAAGCTATAAAGTTGG - Intronic
908705447 1:66948966-66948988 CAGAACTATTGTTTAAAAGTAGG + Intronic
908741681 1:67335301-67335323 CAGAACTCTAGCTAAAGAGTTGG + Intronic
909358646 1:74736884-74736906 CAGAATTAAAATTCAAAATTTGG - Intronic
909924168 1:81419062-81419084 CAGAACTAAAGCTCAAAAGTAGG + Intronic
909987621 1:82182128-82182150 CAGAACCTAAGCTTGAAAGTTGG + Intergenic
910280328 1:85493441-85493463 CAGTACTAAACTTCAATAGTTGG - Intronic
911291881 1:96066202-96066224 GAGTCCCAAAGCTCAAAAGTAGG - Intergenic
913549893 1:119907178-119907200 CAAGTCCAAAGCTCAAAAGTAGG - Intergenic
914387906 1:147189596-147189618 CAGAACTTAAGCTCAATCGCTGG - Intronic
914814242 1:151051781-151051803 CAGAAATAGAGCTTAAAATTTGG + Exonic
915210606 1:154306131-154306153 CAGAACTAACCATCAAAAGCTGG - Intergenic
915531967 1:156508000-156508022 GAGAAGAAAAGCTCAAAGGTGGG - Intergenic
917014678 1:170516592-170516614 CAGAACTCAACCTCTACAGTGGG + Intergenic
918001816 1:180504042-180504064 CAGAAGTAATGCTCAAAACTAGG - Intergenic
918557152 1:185816664-185816686 CAGAACTAATGCCCCAATGTGGG + Intronic
922132191 1:222790887-222790909 CAGAGCTAAAGCTCAGACCTTGG + Intergenic
922779989 1:228244430-228244452 CTGAGCTCCAGCTCAAAAGTGGG + Exonic
923286390 1:232500124-232500146 CAGAACTAGTACTCAACAGTGGG - Intronic
1066550969 10:36556537-36556559 GAGAAGTAAAGCTCAAATTTAGG + Intergenic
1069291680 10:66787657-66787679 CACAACTAACGCACAGAAGTCGG + Intronic
1071169790 10:82850602-82850624 CAGCATGAAAGCTCAAAAATTGG + Intronic
1071779143 10:88823395-88823417 CAAAACTTCAGCTCATAAGTCGG + Intronic
1072521001 10:96230041-96230063 CAGATCTAAAACTCACAGGTTGG + Intronic
1072521648 10:96235127-96235149 CAGAGCTTAAGCCCAAATGTGGG - Intronic
1072955171 10:99881758-99881780 CAGAACGAGAGATTAAAAGTGGG - Intronic
1073217880 10:101846573-101846595 CAAAACTAAAATTCAAAAGGCGG + Exonic
1073648073 10:105327562-105327584 CAGAACTAAAGCTCAGAATGAGG - Intergenic
1074068260 10:110038402-110038424 AAGAACTAGAGCTCAAATCTGGG + Intronic
1077743300 11:4872001-4872023 CAAAACTAAAGCTTAAATATAGG - Intronic
1078487548 11:11738130-11738152 CAGATTGAAAGCTCAAAAGAAGG + Intergenic
1078570094 11:12450432-12450454 CAGACCCAGAGCTCAATAGTGGG - Intronic
1080674042 11:34408070-34408092 CAGAAGTGAAGTTCAACAGTAGG + Intergenic
1080869130 11:36221727-36221749 CAGAACAAATGCTACAAAGTAGG + Intronic
1081106930 11:39081838-39081860 CAGAACTTGAGCACAGAAGTGGG + Intergenic
1084760896 11:71270246-71270268 CTGGACAAAAGATCAAAAGTTGG + Intergenic
1087059107 11:93961262-93961284 CAGAACTGACACTCAAATGTAGG + Intergenic
1087856545 11:103098398-103098420 TAGAAATAGAGTTCAAAAGTTGG - Intergenic
1089681129 11:120119557-120119579 CAGGCCCAGAGCTCAAAAGTAGG - Intronic
1091506651 12:1076143-1076165 CAAAAATAAAGCTCACAAATGGG - Intronic
1091833423 12:3567167-3567189 CATAGCTAAAGCTCAACAGAAGG - Intronic
1093566959 12:20618303-20618325 CAGGGCTAAAACTCAAAAGAAGG - Intronic
1093906028 12:24692811-24692833 CACATCTAAAGCTCTAAAGCAGG - Intergenic
1095260118 12:40088158-40088180 AAGACATAAAGCTCAAAAGGGGG + Intronic
1096676665 12:53230025-53230047 CAGAACCAAGGCTCAGAAATGGG - Intronic
1097332573 12:58347824-58347846 TAGAAGTAAGGCTCAAAAGCAGG - Intergenic
1097475342 12:60048120-60048142 TAGATATAAAGCACAAAAGTTGG - Intergenic
1101452905 12:104796640-104796662 CAGAATAAAAGCTCTATAGTGGG - Intergenic
1102063253 12:109951456-109951478 CAAAACTAAAACATAAAAGTAGG + Intronic
1106836855 13:33643998-33644020 CAAAACTGAAGCTAACAAGTAGG - Intergenic
1108353147 13:49605692-49605714 CAGAACTCAAACTCAAACCTAGG + Intergenic
1108505474 13:51108750-51108772 CAGAACTAAAATTCAAATCTTGG + Intergenic
1109068700 13:57735427-57735449 CAGTACGAAAGCTCACATGTTGG + Intergenic
1109761097 13:66829952-66829974 CAAAACTAAAGAAAAAAAGTTGG - Intronic
1109881643 13:68486171-68486193 CAAAACTAAAGCTGATAAGAGGG - Intergenic
1111996826 13:95173659-95173681 TAGAACTGTAGCTTAAAAGTAGG + Intronic
1114373961 14:22123016-22123038 CGGAAGTGAAGTTCAAAAGTAGG - Intergenic
1116202022 14:41809014-41809036 CATAACTAAAGTTCAACAGCAGG - Intronic
1118236761 14:64012234-64012256 CAAAACTAAAGCTGAAACCTTGG - Intronic
1119865212 14:77967391-77967413 CACAACCTAAGCACAAAAGTGGG - Intergenic
1120364698 14:83551206-83551228 CACAACTAAAAAGCAAAAGTTGG - Intergenic
1120390382 14:83899701-83899723 CAGAGCTAAAGCACACATGTGGG + Intergenic
1125179978 15:36871366-36871388 TAGGTCTAAAGCTCAAATGTAGG + Intergenic
1126240410 15:46435966-46435988 GAGAACTAGGGCTCAACAGTGGG - Intergenic
1127004251 15:54548162-54548184 CAAAACAAGAGTTCAAAAGTGGG - Intronic
1129033411 15:72634821-72634843 CAGAAATAAAGTTAAAAGGTGGG - Intergenic
1129216474 15:74102409-74102431 CAGAAATAAAGTTAAAAGGTGGG + Intronic
1129487271 15:75886415-75886437 TAAAACTAAAGCACAATAGTTGG - Intronic
1129586028 15:76866167-76866189 CTGAAGTAGAGCTGAAAAGTAGG - Intronic
1129965250 15:79729226-79729248 CAGAACTAAAACTCAGAGATGGG - Intergenic
1130569257 15:85025843-85025865 CAAACCTGAAGCTCAAAGGTGGG - Intronic
1130816223 15:87436837-87436859 CAGAACTAAAAATAAAAATTAGG + Intergenic
1134197748 16:12171849-12171871 CAGAACTGATGATCAAAACTAGG - Intronic
1134369418 16:13609215-13609237 CAGAACCTAAGCATAAAAGTGGG + Intergenic
1137410138 16:48221379-48221401 CACAACTATAGGTCATAAGTTGG + Intronic
1138951414 16:61917779-61917801 AAGAAGTAAAGCTGTAAAGTTGG + Intronic
1139321225 16:66116036-66116058 CAGTACTGAAGCTCTAGAGTAGG - Intergenic
1140427040 16:74869750-74869772 CAGAACTAAATCTCCCATGTTGG - Intergenic
1141597005 16:85103519-85103541 CAGAAGCACAGCTTAAAAGTGGG - Intronic
1146884251 17:36460393-36460415 CAGAAGTAAACTTCAAATGTTGG - Intergenic
1149630155 17:58115728-58115750 CAGAAATAAAGCACAAAAGTAGG - Intergenic
1151931399 17:77234198-77234220 CAGAACTCAAGCCAAAAAGCTGG - Intergenic
1152246529 17:79187564-79187586 CAGAACTAGATCTCCACAGTGGG + Intronic
1152997800 18:424620-424642 CAGAGCTCAAGCCCAAAGGTTGG + Intronic
1153579541 18:6558326-6558348 CAGAACTAAAGATCAGGAGGTGG + Intronic
1155518051 18:26642476-26642498 CAGAACTAAAAATCAAAATTGGG - Intronic
1156351625 18:36306951-36306973 AAAAAATAAAGCTCAAAAATAGG - Intronic
1162150040 19:8638623-8638645 CAGAAATAAAGATGAAGAGTTGG + Intergenic
1163042649 19:14614062-14614084 CAGAACCAAAACTCAGTAGTGGG - Intergenic
1166274193 19:41740419-41740441 CAGAGCTAAAGCTCGATAGTTGG + Intronic
1166428273 19:42699018-42699040 CACAACTAAAGCTCTATAGTTGG - Intronic
1167629021 19:50612171-50612193 AAGAACTAAAACTCAACAATAGG - Intergenic
1167666880 19:50827442-50827464 TAGAACTGAGGCTCAAAAGCTGG + Intronic
925628200 2:5862938-5862960 TAGAAGTAAAGTTCAAAAGAAGG + Intergenic
927232451 2:20837351-20837373 CATCACAAAAGCACAAAAGTTGG - Intergenic
927302179 2:21527504-21527526 CAGAAACAAAGCTCCAAATTTGG + Intergenic
929674103 2:43907436-43907458 CAGAAGGAAAGATCAAAATTAGG - Intronic
933813729 2:86049456-86049478 CAAAACTCAGGCTCAAAATTGGG + Intronic
938717376 2:134033221-134033243 CATAACAAAAGCTGAAAACTTGG - Intergenic
939647153 2:144714549-144714571 CTGAACTAACTCTCAAACGTAGG - Intergenic
939712715 2:145542951-145542973 CAATACTAAAACTCAACAGTAGG - Intergenic
939805969 2:146776351-146776373 CTGAACTATAGATCAAAAGATGG + Intergenic
940399726 2:153234329-153234351 CAGAAGTAATGATCAAAACTAGG + Intergenic
944163870 2:196696103-196696125 CACAGCCAAAACTCAAAAGTAGG - Intronic
944969120 2:204971332-204971354 CAGAACTAAAGCTCAGGGATGGG + Intronic
946300861 2:218823269-218823291 AAGAACTAAAGCTTAAAGGAAGG - Intronic
946441103 2:219696753-219696775 AAGAACTTAGGCTCAAAATTAGG + Intergenic
946953293 2:224900614-224900636 CAGAACCAAAATTCAAAACTAGG - Intronic
1169648006 20:7835004-7835026 CAGCACAAACGCTCAAAATTAGG - Intergenic
1172478189 20:35254454-35254476 CACAACTATACCCCAAAAGTGGG + Exonic
1172622801 20:36330871-36330893 CAAAATAAAAACTCAAAAGTCGG - Intronic
1177461322 21:21414966-21414988 CAGCACTATATCTCAACAGTGGG + Intronic
1178996488 21:37405354-37405376 CAGAACTAAAGCCAAGAATTAGG - Intronic
1182784965 22:32899742-32899764 AAGAACGAAGGCTCAAAAGAGGG - Intronic
950195060 3:11003480-11003502 CAGAGCTGAAACTCAAAACTGGG + Intronic
951005364 3:17609676-17609698 CAGAACTATAGATAAAAATTTGG - Intronic
951289723 3:20861048-20861070 AAGAAGTAAAGCTCATAACTGGG - Intergenic
953465230 3:43114057-43114079 CTGAACCAAAGCACGAAAGTAGG + Intergenic
953553192 3:43920926-43920948 CAGAACAAAAAGTCAAAAATAGG - Intergenic
954281596 3:49583308-49583330 CAGAAATAAAGCCCAATAGAAGG + Intronic
955352374 3:58203305-58203327 GAGCACAAAAGCTCAGAAGTGGG - Intronic
956430420 3:69180788-69180810 CAGTACTCAGGGTCAAAAGTGGG - Intronic
957504753 3:81105288-81105310 CAGAACAAAAACAAAAAAGTAGG - Intergenic
957728611 3:84102283-84102305 CAGGACTAAAGATAAAAACTTGG + Intergenic
957790366 3:84932868-84932890 CAGAACTTAACCTCAGCAGTGGG - Intergenic
957936149 3:86945222-86945244 TAGATCTGAAGCTCAAAAGACGG + Exonic
959101550 3:102016043-102016065 CAGAACTAAAGAGAAAAATTGGG - Intergenic
960301069 3:116003215-116003237 CATATCTAAAGCTCAAATGTAGG + Intronic
960453838 3:117844910-117844932 CAGAACTTATGCTCTAAAGTTGG + Intergenic
960634007 3:119765627-119765649 TAGATCTAAAGCTCAAAGGTGGG - Exonic
961082546 3:124038665-124038687 CAGAACCAATGCTCAACAGAAGG - Intergenic
961954168 3:130783508-130783530 CAGAAGCAAAGCACAAAAGTAGG + Intergenic
962935740 3:140079012-140079034 CAGAACTAGGACTCAAAAATAGG - Intronic
965598335 3:170430102-170430124 CAGCCCTAAACCTCAAAAGTGGG - Intronic
965869208 3:173246513-173246535 TAGAACTAATGCTACAAAGTAGG + Intergenic
966943946 3:184764517-184764539 CAGACCCAAAGTTCCAAAGTAGG - Intergenic
971416096 4:26431497-26431519 TAGAGCAAAAGCTCAAAGGTGGG - Exonic
971455068 4:26836487-26836509 CAGGACAACAGCTCAAAAGCTGG - Intergenic
971699632 4:29953937-29953959 CAGAGCTATTGCTCAAAAATTGG + Intergenic
973862835 4:55082873-55082895 CAGAACTGGACCTCAGAAGTAGG - Intronic
974324729 4:60398783-60398805 CAGAGCTGAAGCACAAAATTTGG + Intergenic
975024569 4:69532381-69532403 CATAACCAAACCTCAAAAGTGGG - Intergenic
975282116 4:72572976-72572998 CAGGAATAAAGCTCATCAGTAGG - Intergenic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
975988036 4:80223436-80223458 CAAAATTAAAGCTCAAGAGATGG - Intergenic
978530277 4:109705296-109705318 GAGCACTAGAGCTCAACAGTGGG - Intergenic
979446706 4:120822191-120822213 CAGAACTGAAGCTGTAAAGCGGG + Intronic
980474414 4:133293663-133293685 CATAAATAAAGCTCTAAAGGTGG + Intergenic
980601372 4:135030002-135030024 AAGAAATACAGCTCAAAATTTGG + Intergenic
981979831 4:150777668-150777690 CAAGACTAAAGGTCAAAACTAGG + Intronic
983855721 4:172641486-172641508 CAGAACAAAGGCTCTAAAGCAGG - Intronic
986003341 5:3647611-3647633 CAAAAACAAAGCTCAAAATTAGG - Intergenic
986397752 5:7346994-7347016 GAGGACTAAAGCTCAGAAGTGGG + Intergenic
987528720 5:19086886-19086908 CAGAAGTAAATTTCAAAAATTGG - Intergenic
990146635 5:52768491-52768513 CAGAAAGAAAGCTGAGAAGTTGG - Intergenic
990615196 5:57500767-57500789 CAGATTTAAGGCTCACAAGTTGG - Intergenic
994187843 5:96835728-96835750 CAGTACGAAGGCTCACAAGTCGG + Intronic
995802621 5:116015130-116015152 CAGATATAAAGGTCAAAAGTAGG - Intronic
995989580 5:118220973-118220995 AAGAAGTAAATCTCAACAGTGGG + Intergenic
996539916 5:124619600-124619622 CAGAACTAAAACTTAGAAATAGG + Intergenic
999493057 5:152070563-152070585 CAGAACCAAGTCTCCAAAGTAGG - Intergenic
999922527 5:156337495-156337517 AAGAACTGAAGCTCAAGAGTTGG - Intronic
1000175377 5:158747181-158747203 CACAACTAAAACTCAAATGTTGG + Intronic
1001035746 5:168295133-168295155 CAGAACTAAAAGGCAAAAATGGG - Intronic
1001318664 5:170662651-170662673 CAGAACCTAAGCTCTTAAGTAGG - Intronic
1003035289 6:2636251-2636273 CAGAACTAAAGCAAAACAGAAGG - Intergenic
1003453041 6:6254965-6254987 AAAAACTAATGCACAAAAGTTGG - Intronic
1004136883 6:12976028-12976050 CAGAAATAAAGTTCAGAAGGGGG - Intronic
1005669411 6:28090144-28090166 TTGAACTAAACCTCAGAAGTTGG + Intergenic
1007796367 6:44351525-44351547 GAGCACTAAAGCTCAATAGATGG - Intronic
1008603652 6:53119669-53119691 CAGAATTAAAGTTTAGAAGTTGG + Intergenic
1012331116 6:97988799-97988821 TTAAACTAAAGGTCAAAAGTTGG - Intergenic
1012798203 6:103790617-103790639 CAGGAATTAAGCCCAAAAGTTGG - Intergenic
1012819355 6:104065683-104065705 CAGAACTTAAGCTCTAATGAGGG + Intergenic
1013375766 6:109512487-109512509 CAGAACCAAACCTCAAGAGAAGG - Intronic
1013699670 6:112750108-112750130 CAGTCCCAAACCTCAAAAGTAGG + Intergenic
1014002218 6:116376959-116376981 TAGAAATAAAACTCAAAAGGTGG - Intronic
1015001635 6:128223800-128223822 CAGGACTAAAATTCAAAACTAGG + Intronic
1016546096 6:145226198-145226220 CAGAACAAAACCTCGAAAGTGGG + Intergenic
1016647554 6:146427287-146427309 AAGAGCTAAAGGTCAAAAATGGG - Intronic
1016777403 6:147919685-147919707 CAAAACTCAAGTTCAAAAATGGG - Intergenic
1017681175 6:156865509-156865531 CAAAACTAAAGACCAAAAGAAGG - Intronic
1017969316 6:159297839-159297861 CAGAAGTAAAGCTTGAGAGTGGG - Intergenic
1020728286 7:11844507-11844529 CAGAACAAAAGGTCAGGAGTTGG - Intergenic
1020763870 7:12297541-12297563 CAGAAGGAAAGCTCAAGAATGGG + Intergenic
1020800751 7:12729269-12729291 CAGAACTAAACCTCGCAAGCAGG + Intergenic
1021529622 7:21630221-21630243 GACAACTAAAGCTCAAAATGTGG - Intronic
1022266395 7:28759331-28759353 CAGAAGTAAACATCAAAATTGGG - Intronic
1024542978 7:50494150-50494172 AAGAACTAAAGCATTAAAGTGGG - Intronic
1025815261 7:64904923-64904945 CAGTACTAAAACTCAAAACCAGG - Intronic
1028117550 7:87017618-87017640 CAGAAGTAAAACACAAAAATAGG + Intronic
1028162871 7:87506024-87506046 CAGAAATATAGCACTAAAGTAGG - Exonic
1028634682 7:92974337-92974359 CAGAATTTTAGCTCAAAATTTGG + Intergenic
1030161677 7:106515813-106515835 CTGAACTAAAGATCATAGGTGGG + Intergenic
1030253983 7:107486085-107486107 CAGAGATAAAGCTGAAAAATAGG + Intronic
1030923926 7:115427610-115427632 CAGAAATAAATCTCAAAATCAGG - Intergenic
1032155606 7:129465107-129465129 CAGAATTATATCTCAAATGTTGG - Intronic
1032530258 7:132614505-132614527 TGGAAATAAAGCTCAAAGGTGGG + Intronic
1032566642 7:132953794-132953816 CAGGAGTAAAGGTCATAAGTAGG + Intronic
1032850827 7:135793657-135793679 CAGAGCAAAAGCACAAAGGTGGG - Intergenic
1032982646 7:137301620-137301642 CAGAACAGAAGCTTAAATGTTGG + Intronic
1034279425 7:149842297-149842319 CAGAGCTAAAGTTAGAAAGTGGG + Intronic
1039770061 8:40676824-40676846 TAGAAATAAAGCTCAAATGTGGG + Intronic
1045355366 8:101383458-101383480 GAGAAGTAGATCTCAAAAGTGGG + Intergenic
1047152047 8:122274531-122274553 CAGAACTAAGGTTCAGAAGGTGG + Intergenic
1047632208 8:126720683-126720705 GAGAACTAAAGCTAAAGAGATGG + Intergenic
1047632508 8:126723775-126723797 CAAAACTAAAGACCAAAAATAGG - Intergenic
1050053794 9:1631055-1631077 CAGAAGCAAAGCTCAGAAGAGGG + Intergenic
1050115884 9:2263022-2263044 CAGAACAAAGCCTCAACAGTTGG + Intergenic
1052406574 9:28068751-28068773 CAAAAATCAAGCTTAAAAGTTGG - Intronic
1052631535 9:31047636-31047658 CAGTACTAAATCTCATAAGAAGG - Intergenic
1055096302 9:72418022-72418044 AAGAACTGAAACTTAAAAGTTGG - Intergenic
1055424965 9:76185279-76185301 CATTGCTAAAGCTCAATAGTTGG + Intronic
1056925773 9:90833396-90833418 CAGAACTAAAACTCTAAGGTGGG + Intronic
1057580420 9:96282514-96282536 TAGAACTAATGCGCCAAAGTAGG - Intronic
1058430023 9:104910051-104910073 CAGCACTAAAGCTCATGTGTTGG - Intronic
1058475587 9:105329320-105329342 CAGCACTAAAGCTGGAAAGCAGG - Intronic
1058811930 9:108648196-108648218 CAGAATCAAAGCTCAGCAGTGGG - Intergenic
1059254123 9:112913324-112913346 GAGAACTAAAGTGCAAAAGAAGG - Intergenic
1059752196 9:117258384-117258406 CACAACTCAGACTCAAAAGTGGG + Intronic
1186045434 X:5531931-5531953 CAGAACCAAAGCTCAAATTGAGG + Intergenic
1186130004 X:6456259-6456281 CAGCCCTAAAGCTCAGAAGTTGG + Intergenic
1189014605 X:37084037-37084059 CAGTACTAGATCTCAACAGTGGG - Intergenic
1189139187 X:38583191-38583213 CAGAATGAAAGCTAAAAAATGGG - Intronic
1189182100 X:39014172-39014194 CAGGACTAAAGTTCAAAGGGTGG + Intergenic
1189279323 X:39810118-39810140 CAGGGCTAAAGCACAGAAGTGGG + Intergenic
1193002886 X:76582963-76582985 CATCACCAAAGATCAAAAGTCGG - Intergenic
1193562295 X:83033045-83033067 CACAACTGAAGCCCAAAACTTGG + Intergenic
1193752898 X:85368981-85369003 CAGAACTATAGCTATAATGTAGG + Intronic
1194777418 X:97982031-97982053 CTGAACTAAAGTTAAAAACTTGG + Intergenic
1194782031 X:98035300-98035322 CAGAAATCTAACTCAAAAGTAGG + Intergenic
1194841497 X:98749683-98749705 CAAAAAAAAAGTTCAAAAGTAGG - Intergenic
1195323368 X:103739015-103739037 TAGATATAAAGCTCTAAAGTAGG + Intergenic
1195772353 X:108364913-108364935 TAGAAATAAGGCTCAAAATTAGG - Intronic
1197614933 X:128680374-128680396 CAGAATTAAAGCTCAAAAAAGGG + Intergenic
1198634471 X:138680589-138680611 CAGCAGTAAGTCTCAAAAGTAGG + Intronic
1198775585 X:140175856-140175878 CACAACTAAATCTCAAAAGCTGG - Intergenic
1199138086 X:144277338-144277360 CAGACCTAAAGGGCAAAATTTGG + Intergenic
1200308067 X:155048518-155048540 CAGTACTAAAGCTTAATATTTGG + Intronic