ID: 909929313

View in Genome Browser
Species Human (GRCh38)
Location 1:81477090-81477112
Sequence CCATTGCCACTAACCCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909929309_909929313 26 Left 909929309 1:81477041-81477063 CCTCTCTGTTCACAGAACTACTT 0: 1
1: 0
2: 3
3: 15
4: 228
Right 909929313 1:81477090-81477112 CCATTGCCACTAACCCACCCTGG No data
909929311_909929313 -8 Left 909929311 1:81477075-81477097 CCTCAGATTGGTTGACCATTGCC No data
Right 909929313 1:81477090-81477112 CCATTGCCACTAACCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909929313 Original CRISPR CCATTGCCACTAACCCACCC TGG Intronic
No off target data available for this crispr