ID: 909933090

View in Genome Browser
Species Human (GRCh38)
Location 1:81520620-81520642
Sequence CAGGCAAGAGAGTCTGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 7, 3: 42, 4: 426}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909933090 Original CRISPR CAGGCAAGAGAGTCTGAAGG AGG (reversed) Intronic
900928906 1:5723830-5723852 CAGGCAAGAGAGTGTGTGCGGGG - Intergenic
902200763 1:14831793-14831815 CAGGCAAGATAAGCTGGAGGAGG - Intronic
903202867 1:21756825-21756847 CAGCCAAGAGAAACTTAAGGTGG - Intronic
903532655 1:24043623-24043645 AAGGCAATAGAGACTGAGGGAGG - Intergenic
903758921 1:25684236-25684258 CAGATAAGAGAGACTGAAGGAGG + Intronic
904886493 1:33742454-33742476 CAGTCAAGTGAGGCTGGAGGTGG - Intronic
907315282 1:53566732-53566754 CAGGAAAGAGAGAGAGAAGGTGG - Intronic
908097251 1:60751936-60751958 CAGGCCTGAGTGTCTGCAGGGGG - Intergenic
908166434 1:61463540-61463562 CAGGCAAGGGAGTCTGGAAAAGG + Intergenic
908386567 1:63648273-63648295 CAGGAGAGAGAGAGTGAAGGGGG + Intronic
908814086 1:68013815-68013837 CAGTCAAAAGAGAGTGAAGGGGG - Intergenic
909440438 1:75690260-75690282 CAGGCAAGAGAGACAGAGGCAGG + Intergenic
909569536 1:77093097-77093119 CAGGTGGGAGAGTCTGGAGGAGG - Intronic
909933090 1:81520620-81520642 CAGGCAAGAGAGTCTGAAGGAGG - Intronic
910587336 1:88893852-88893874 CAGACAAGAGACTCTCCAGGTGG - Intergenic
911739384 1:101370302-101370324 CAGGGCAGAGAGTGTGATGGAGG + Intergenic
912372577 1:109185382-109185404 CAAGCAAGAGAGAATGAAGTGGG - Intronic
912524368 1:110270206-110270228 CAGAGAGGAGAGTCTGAGGGCGG - Intronic
912968936 1:114262157-114262179 CAGGAAAGATAATCTGTAGGAGG + Intergenic
913430577 1:118786957-118786979 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
914382982 1:147136006-147136028 CAGGCAAGCCAGTCTTAAAGCGG - Intergenic
915480086 1:156178521-156178543 CAGGAAAGAGAGACTGAGTGGGG - Intergenic
916446015 1:164872447-164872469 GAGGCAAGAGAAGCTCAAGGAGG - Intronic
916466803 1:165081129-165081151 CATTCTAGAGAGTATGAAGGAGG - Intergenic
917668468 1:177248700-177248722 CAGGCACGAGACCCTGCAGGGGG + Intronic
918254592 1:182737545-182737567 CAGGCAAGAGAGTGTGTGGAGGG - Intergenic
919824429 1:201493455-201493477 CAGGCAAGAGAGCTTGTATGGGG - Intronic
919829511 1:201530703-201530725 CAGGCCACAAAGGCTGAAGGGGG + Intergenic
920119258 1:203643453-203643475 CAAGCAAGAGAGTCTCAGGCTGG + Intronic
920439685 1:205971432-205971454 AAGGCAAGGGAGTGAGAAGGAGG - Intergenic
920751590 1:208683057-208683079 CAGCCAAGAGAGGCTAAAGATGG + Intergenic
921162397 1:212482538-212482560 AAACCAAGAGATTCTGAAGGAGG + Intergenic
921270706 1:213466948-213466970 CAGGCATAAGAGCCTTAAGGAGG + Intergenic
921658581 1:217770915-217770937 CATGATGGAGAGTCTGAAGGGGG + Intronic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
922157154 1:223049448-223049470 CAGGAAAGACACTGTGAAGGAGG + Intergenic
922685761 1:227637815-227637837 GAGGCAGGAGAGACTGGAGGAGG + Intronic
923296293 1:232597769-232597791 CAGGCAAGAGAGGCTGATCTTGG + Intergenic
924120442 1:240792520-240792542 CAAGAAAGAGGGTCTGAAGAAGG - Intronic
924200196 1:241650527-241650549 AAGGCAAGAGAGTCAGGGGGTGG - Intronic
1063110800 10:3035536-3035558 CAGGCAAGAGAGCATGTGGGGGG + Intergenic
1063262013 10:4400291-4400313 CAGGCAAGAGAGTGTGTACAGGG - Intergenic
1063550757 10:7030679-7030701 CAGGCAAGAGAGAGAGAAGGGGG + Intergenic
1063581709 10:7313946-7313968 CTGGGAAGTGAGTTTGAAGGGGG + Intronic
1064775247 10:18769828-18769850 CAGGCAAGAGAGTGTGTGCGGGG + Intergenic
1064858610 10:19799294-19799316 CAGGAAAGAGAGAGTGAAGGGGG + Intergenic
1066635706 10:37496878-37496900 CAGGAAAGAGAGTGAGAAGGGGG - Intergenic
1066711874 10:38245152-38245174 CAGGCAAGAGAGTGTGCAGGGGG + Intergenic
1067572869 10:47384484-47384506 CAGCCCAGAGGGTCAGAAGGGGG - Intergenic
1068244270 10:54343330-54343352 CAGGAGAGAGAGAGTGAAGGGGG - Intronic
1068944740 10:62718477-62718499 CAGGAAAGAGATGCTGAAGTAGG - Intergenic
1070190380 10:74106603-74106625 AATGCAAGAGAGTAGGAAGGAGG + Intronic
1070651423 10:78239872-78239894 AAGGCAAGAGAGGGTGGAGGGGG - Intergenic
1070951942 10:80438018-80438040 CAGGCAAGAGAGAATGGTGGTGG + Intergenic
1071303375 10:84274640-84274662 CAGGAGAGAAAGGCTGAAGGGGG + Intergenic
1072627680 10:97123973-97123995 CAGGCAACACTGTCTGATGGAGG - Intronic
1073062257 10:100739864-100739886 CGGGCGAGAGAGTCGGAGGGAGG - Intronic
1073577451 10:104638735-104638757 CAGACAGGAGAGACAGAAGGAGG + Intergenic
1074014159 10:109516413-109516435 CAGAAAAGCGAGTCTGAAGATGG + Intergenic
1074243069 10:111658346-111658368 CAGGCAAGAGTGTGAGAAGAGGG - Intergenic
1075511002 10:123073075-123073097 CAGACAAGAGAGCTTTAAGGCGG + Intergenic
1076127112 10:127983906-127983928 CCGGCAAGAGATTCAGAAGTAGG + Intronic
1076160417 10:128240039-128240061 CTGGCAACAGAATCTGCAGGAGG + Intergenic
1078401252 11:11029301-11029323 CAGGGAAGAGGCTCTGAAGAGGG + Intergenic
1078431171 11:11289933-11289955 CAGGCAGAGGAGTCTGAAGAGGG + Intronic
1079872507 11:25817255-25817277 AAGGGAAGAGAGTTTGGAGGTGG + Intergenic
1082898979 11:58225584-58225606 CAGGCAAGAGAGTGTGCACAGGG + Intergenic
1084512551 11:69615383-69615405 CAGGCAAGAGACTATGAGGATGG + Intergenic
1085529543 11:77183335-77183357 CAGACAGGAGTGTCTGAAGAGGG + Intronic
1085875619 11:80403667-80403689 CAGGCAAGAGAGCCTGTGGAGGG - Intergenic
1087097025 11:94328884-94328906 CAGGCAGCAGAGGCTGGAGGTGG + Intergenic
1087827983 11:102787884-102787906 CAGGCAACAGAGTATGATGGTGG + Intergenic
1088757649 11:112899503-112899525 CAGGCAAGTCAGTGTGAAGCCGG + Intergenic
1089750140 11:120645753-120645775 CAGGCAAGGGAACGTGAAGGCGG - Intronic
1089969792 11:122683516-122683538 GAGGCAGGAGAATCTGGAGGCGG + Intronic
1090711756 11:129392683-129392705 CAGGAAAGAGAGGCTGCAGTGGG - Intronic
1090717172 11:129440841-129440863 CAGGCAAGTGAGACTGACTGTGG + Intronic
1090997065 11:131876383-131876405 CTAGCCAGAGAGTCTGAATGTGG - Intronic
1092000186 12:5025243-5025265 CAAGCAAGAGAGGCTGAACTAGG + Intergenic
1092139495 12:6173091-6173113 CAGGAAAGAGAGTGTGAGGGGGG - Intergenic
1092250724 12:6894501-6894523 CAGGCGAGAGAGTGTGAAGGAGG - Intronic
1092950433 12:13498555-13498577 CAGGAAAGACACTCTGAGGGAGG - Intergenic
1094351436 12:29530273-29530295 TAGGAAAGAGAGTCTAATGGTGG - Intronic
1094533544 12:31300349-31300371 CAGGCAAAAGAGTGGGATGGGGG + Intronic
1094771287 12:33663001-33663023 CAGGACTCAGAGTCTGAAGGAGG + Intergenic
1097174778 12:57136229-57136251 CAGGGGAGGGAGGCTGAAGGGGG + Intronic
1097178980 12:57160120-57160142 CAGGAATGAGAGTCTGCAAGGGG + Intronic
1097403640 12:59161101-59161123 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
1098577395 12:72058695-72058717 CAGCTAAGAGAGACTGAGGGAGG - Intronic
1099688692 12:85922870-85922892 CAGGCAAGAGAGAGTGAAGGGGG + Intergenic
1101202534 12:102451933-102451955 CAGGTGAGAGAGTGTGAAGAGGG - Intronic
1101237525 12:102804623-102804645 CAGGCAAGTGAGTCTGAGTTGGG - Intergenic
1101799398 12:108007510-108007532 CAGGAAAGAGAGTGAGAAGAGGG + Intergenic
1102500575 12:113349371-113349393 CAGCTAAGAGAGGTTGAAGGCGG - Intronic
1102549320 12:113679795-113679817 CAGGTTGGAGAGTCTGAATGGGG - Intergenic
1105465811 13:20639025-20639047 CAGGGAAGAGAATGTGATGGTGG - Intronic
1106187452 13:27421905-27421927 TAGGCAAGAGAGACTAAAGGCGG + Intergenic
1107676414 13:42802431-42802453 CAGGAGAGAGAGAGTGAAGGGGG - Intergenic
1107988280 13:45794631-45794653 CAGGCAAGAGAGTGTGTGGAGGG - Intronic
1108522427 13:51258479-51258501 CAGACATTAGAGTCTGAAGAGGG - Intronic
1108762106 13:53580538-53580560 CAGGCAAGAGAGTGTGTGGCAGG + Intergenic
1109722608 13:66294815-66294837 AATGCAACAGAGTCTAAAGGAGG + Intergenic
1110075123 13:71230753-71230775 CAGGCAAGAGAGTGTGTACAGGG + Intergenic
1110228113 13:73140985-73141007 CAGGGACGAGAGTCTGGAGGGGG + Intergenic
1110385378 13:74904777-74904799 CAGGCAAGCGAGTGAGAAGGGGG - Intergenic
1110832183 13:80044260-80044282 CAGGGGAGAGAGAGTGAAGGGGG - Intergenic
1111918102 13:94382756-94382778 GAGGCAAGACATTCTGAATGAGG - Intronic
1112383933 13:98920146-98920168 CAGAAAAGAGACACTGAAGGAGG + Intronic
1112512384 13:100021119-100021141 CAGGAGAGAGAGAGTGAAGGTGG - Intergenic
1112743096 13:102496680-102496702 CAGGAGAAAGAGTGTGAAGGGGG + Intergenic
1113217883 13:108063417-108063439 CAGGAAAGAAAGAATGAAGGAGG + Intergenic
1113593306 13:111515326-111515348 CTGGCATGAGGGTCTGAGGGAGG + Intergenic
1113593321 13:111515384-111515406 CTGGTATGAGAGTCTGAGGGAGG + Intergenic
1113702844 13:112399904-112399926 CAGGAGAGAGAGAGTGAAGGGGG + Intronic
1113932825 13:113977198-113977220 CAGGCAGGAGAGGGTTAAGGGGG - Intergenic
1113943700 13:114032469-114032491 CAGGCAAGGGTTTCAGAAGGTGG - Intronic
1115767515 14:36638624-36638646 CAGGCAAGAGAGTTTGTGCGGGG - Intergenic
1117252153 14:53948727-53948749 CAGGGAAGAGGGTGTGAGGGAGG + Intergenic
1117666035 14:58056950-58056972 AAGGAAGGAGAGTGTGAAGGAGG - Intronic
1120344631 14:83270301-83270323 CAGGCAAAAGTATCTGAAGTTGG - Intergenic
1120895743 14:89530360-89530382 CAGGCAAGAGAGCATGATCGGGG + Intronic
1121863442 14:97340473-97340495 CAGGCAAGAGCTTCAAAAGGAGG - Intergenic
1121989232 14:98539117-98539139 CAGGCAAGAGAGTGTGTGAGGGG - Intergenic
1122583878 14:102790559-102790581 CAGGCAAGAGAGTCTGTGCAGGG + Intronic
1122765352 14:104065699-104065721 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
1124264243 15:28219393-28219415 CAGGCAAGGGAGGCTGAGGGAGG + Intronic
1125969139 15:43897912-43897934 CAGGAAAGAGAGAATGAGGGGGG - Intronic
1126274109 15:46856082-46856104 CAGGCAAGCAATTATGAAGGTGG - Intergenic
1126332041 15:47543408-47543430 CAGGCAAGAGAGTGTGTACAGGG - Intronic
1126379528 15:48031603-48031625 AAGGCAAGAGAGCATGAAGGAGG + Intergenic
1126682251 15:51213775-51213797 CAGTAAAGAGAGACCGAAGGAGG - Intronic
1126763252 15:51988889-51988911 CAGCCACCAGAGGCTGAAGGAGG - Intronic
1126918214 15:53489772-53489794 CAGGCAAGAGAGTGTGTACAGGG - Intergenic
1126942262 15:53780052-53780074 CAGGCAAGAGAGTGTGTACAGGG + Intergenic
1128326972 15:66730049-66730071 TGGGCAAGAGGGTCTGACGGAGG - Intronic
1129082488 15:73052716-73052738 CAGGCAGTAGAGCCAGAAGGAGG - Exonic
1129331793 15:74831657-74831679 CAAGCAAGACAGGCTCAAGGAGG - Exonic
1131517135 15:93087150-93087172 CAGCCCAGAGAGTCTCAAGGGGG + Intronic
1131994434 15:98120457-98120479 CAGGCAAGAGAGTCTGTGCAGGG - Intergenic
1132697047 16:1206685-1206707 CAGTCCAGAGAGGCTGAATGAGG + Intronic
1132732030 16:1367393-1367415 CAGGCAAGAGGGTCTGCAGGTGG - Intronic
1133181794 16:4060326-4060348 CAGGCAGGAAAGACTGAAGAGGG + Intronic
1134046973 16:11108230-11108252 CATGCAGGAGAGACTGAAGCTGG - Intronic
1134340204 16:13337832-13337854 CAGGAGAGAGAGAGTGAAGGGGG - Intergenic
1134845765 16:17438730-17438752 CAGGAGAGAGAGAGTGAAGGGGG + Intronic
1136788856 16:32952370-32952392 CAGGCAAGAGAGACAGAGGCTGG - Intergenic
1136880956 16:33901564-33901586 CAGGCAAGAGAGACAGAGGCTGG + Intergenic
1137586680 16:49668074-49668096 CAGGTAGGAGAGCCTGAAGTTGG + Intronic
1137689071 16:50407702-50407724 CCGGCAAGTGAGTCTGAGGGTGG - Intergenic
1137973726 16:53012264-53012286 CAGTCAACAAAGTCTGGAGGAGG - Intergenic
1138160903 16:54753344-54753366 GATGCAAGGGAGTCAGAAGGTGG - Intergenic
1138249992 16:55494613-55494635 CAGTCAGGAGGGTCTGAAGCTGG - Intronic
1138273976 16:55717634-55717656 CTGGCAAGTGAGACTGATGGTGG + Intergenic
1138708039 16:58937869-58937891 CAGGTGAGAGCGTGTGAAGGAGG + Intergenic
1139083506 16:63556114-63556136 CAGGCAAGGCATCCTGAAGGAGG + Intergenic
1139145670 16:64321839-64321861 CAGGCAGGTGAGTCAGAAAGTGG + Intergenic
1140210457 16:72965407-72965429 CAGACAAGAGAGGATAAAGGAGG + Intronic
1140414447 16:74763905-74763927 CAGGCAAGCAAATTTGAAGGTGG - Intronic
1140626782 16:76803942-76803964 CAGGCAAGAGACAGTGAAGGGGG - Intergenic
1141029459 16:80575038-80575060 CAAGCAAGGGAGACTGAGGGTGG + Intergenic
1141800453 16:86304307-86304329 GAGCCAAGAGAGGCTGAAGTTGG - Intergenic
1203091053 16_KI270728v1_random:1213859-1213881 CAGGCAAGAGAGACAGAGGCTGG - Intergenic
1142808099 17:2382153-2382175 CAGGCAACAGAGTCGGCTGGCGG - Intergenic
1145159119 17:20562755-20562777 CAGGCATGAGAGGGTGAGGGTGG + Intergenic
1146352989 17:32111499-32111521 CAGCCCCGAGAGCCTGAAGGCGG + Intergenic
1147149246 17:38504521-38504543 CAGGCAAGAGAGACAGAGGCTGG - Intronic
1147212240 17:38878422-38878444 AAGGGAAGAGACTCTCAAGGTGG + Intronic
1148988682 17:51646691-51646713 CAGGCAGGGGAGTCTGGAGTAGG - Intronic
1149355563 17:55835715-55835737 CAGACAGGAGAGCCTGATGGGGG - Intronic
1150652681 17:67020072-67020094 CAGGCATGGGAGCCTGGAGGAGG + Intronic
1151031363 17:70744110-70744132 CAGGCCCGAGAGCCTGCAGGTGG - Intergenic
1151077774 17:71293971-71293993 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
1151416411 17:73968873-73968895 CAGAGAAGAGAGGCTGGAGGGGG - Intergenic
1151435762 17:74096118-74096140 AAGGCAAGAGAGTGTGAGGAAGG - Intergenic
1151481018 17:74370135-74370157 CGGGCCAGAGGGTCTGAAGCGGG - Intronic
1151835717 17:76581480-76581502 CAGGCTGGAGAGCCTGACGGAGG + Intronic
1152848270 17:82615862-82615884 CAGCCCCGAGAGTCTGAAGGCGG + Exonic
1154318866 18:13328028-13328050 CAGGGAGGAGAGCCTGATGGTGG - Intronic
1156183922 18:34639386-34639408 CAGGCAAGAGGGTCTCAACCAGG - Intronic
1156865838 18:41887792-41887814 AAGGCCAGAGAGTCTGAAGGTGG - Intergenic
1157187076 18:45549688-45549710 CTGGCAAGGGAGTCTGCAAGAGG + Intronic
1157231820 18:45924308-45924330 CAAGCCAGAGAATGTGAAGGTGG + Intronic
1157942291 18:51942519-51942541 CAGGAATGAGCTTCTGAAGGAGG + Intergenic
1158107270 18:53899861-53899883 CAGGAAAGAGAGATTGAAGGGGG - Intergenic
1158337829 18:56433038-56433060 CAGGCAAGAGAGCGTGAGGAGGG + Intergenic
1159561265 18:69997506-69997528 CAAGCCAGAGAATCTGAAGAGGG + Intergenic
1159718655 18:71858254-71858276 CAGGCAAGAGAGTTTGTATAAGG + Intergenic
1160068943 18:75607665-75607687 CTGGTGAGAGAGGCTGAAGGAGG + Intergenic
1160810501 19:1011028-1011050 CAGGCAGGAGAGGCTGCAGCCGG - Intronic
1162833810 19:13303322-13303344 CAGCCAAGAGGGTGGGAAGGGGG - Intronic
1164611662 19:29636612-29636634 AAGGCCAGAGAGTCAGAGGGAGG - Intergenic
1164748020 19:30630167-30630189 CAGGCAAGAGAGGTTGAATCGGG + Intronic
1165014099 19:32868388-32868410 TAGGCAAGGGCGTCTGAACGAGG - Intronic
1165363846 19:35352096-35352118 CAGGAGAGAGAGGCTGAAGCGGG - Exonic
1165610517 19:37147433-37147455 GAGGCCAGAGAGTCTGCAGTTGG - Exonic
1166123779 19:40701511-40701533 CAAGGAAGAGAGTGTGAAGTGGG - Intronic
1166411751 19:42560205-42560227 GAGGAAAGACAGTCTGATGGGGG - Intronic
1166634180 19:44434993-44435015 CAGGCAAGAGAGGCTGTGGAGGG - Intronic
1166800781 19:45455851-45455873 CAGCCCAGAGTGTCTGCAGGAGG + Intronic
925124981 2:1448053-1448075 CAGGCAGGAGGGGCTGAAGCCGG - Intronic
925437090 2:3847848-3847870 CAGGAGAGAGAGAGTGAAGGGGG - Intergenic
926469616 2:13237815-13237837 CAGGCAAGAGAGCTTGAACAGGG + Intergenic
926598122 2:14812977-14812999 CAGGTAAGAGAGAATGAAGGCGG - Intergenic
927309114 2:21608382-21608404 CATGGCAGAGAGGCTGAAGGAGG - Intergenic
927558343 2:24050969-24050991 CAGGGAGGAGAGACTGAAGATGG - Intronic
928174476 2:29024488-29024510 CAGGCAAGTGAGGCTGCAGGGGG + Intronic
928778192 2:34791267-34791289 CAGGCAAGAGGGAAAGAAGGAGG - Intergenic
928911022 2:36420916-36420938 CAGGCAGGAGAGACTCAAGAAGG - Intronic
928980818 2:37133631-37133653 GACACAAGAGAGGCTGAAGGTGG - Intronic
929100878 2:38312381-38312403 CAGGAGAGAGAGAGTGAAGGGGG - Intronic
929345923 2:40884656-40884678 CAGGCAAGAGAGCATGAGGCAGG - Intergenic
930630978 2:53754963-53754985 AAGGGAAGAGAGTGAGAAGGTGG - Intronic
931086319 2:58834697-58834719 CAGGTGAGAGAGTCTGGAAGGGG + Intergenic
932271918 2:70418557-70418579 CAGGCTACAGAGCGTGAAGGGGG + Intergenic
933391432 2:81673829-81673851 CAGGAGAGACAGTCTGAAGAGGG - Intergenic
934936927 2:98472372-98472394 CAGCCAAGAGAATCTGCTGGGGG - Intronic
936830983 2:116646533-116646555 CAGGCTATGGAGTCTGAAGAAGG + Intergenic
938138758 2:128780016-128780038 CAGGCAAGATAAGCTGCAGGAGG - Intergenic
938771103 2:134501652-134501674 CAGGCTAGCAAGTCTGATGGAGG + Intronic
940366468 2:152853500-152853522 GAGGCAAGAAATTCTGAAGAGGG - Intergenic
940991914 2:160106030-160106052 CAGCCAAGAGAGTGGGATGGAGG - Intronic
941070009 2:160945113-160945135 CAGGCAACAGAGTCAGGTGGTGG - Intergenic
941366789 2:164620089-164620111 AAGGCAAGAGAGAGAGAAGGCGG - Intronic
942232597 2:173874047-173874069 CAGGAAAGAGACTCTGAGAGGGG + Intergenic
943128603 2:183827988-183828010 CAGGAAAGAGAGAGTGAAGAGGG + Intergenic
943701809 2:190995452-190995474 CAGGCAAGAGAGTTTGTGGAGGG + Intronic
943828019 2:192420804-192420826 CAGGCAAGACAGAGTGAAGATGG - Intergenic
944307325 2:198193512-198193534 CAGGAGAGAGAGAGTGAAGGGGG + Intronic
944307585 2:198195503-198195525 CAGGGGAGAGAGAGTGAAGGGGG + Intronic
944439967 2:199732209-199732231 CATGAAAGAGAGTTTCAAGGAGG - Intergenic
945044540 2:205770506-205770528 CAGGCAATAGAGGGTGAGGGTGG - Intronic
945588028 2:211691772-211691794 TAGCCAAGAGAGTCTGAGGAAGG + Intronic
945616084 2:212068972-212068994 CAGGCAAGAGAGCATGTATGGGG - Intronic
945757748 2:213870186-213870208 AAGGGAAGAGAGCCTGAAGGAGG - Intronic
946205125 2:218100374-218100396 CAGGAGAGAGAGAGTGAAGGCGG + Intergenic
946412343 2:219521624-219521646 CAGGCAGGAGGGAGTGAAGGGGG + Intronic
946668485 2:222076463-222076485 CCGGCAAGAGGGCCTGAGGGAGG - Intergenic
947488574 2:230574679-230574701 CAGGAGAGAGTGTGTGAAGGGGG + Intergenic
948397097 2:237653016-237653038 CAGGAGAGAGAGAGTGAAGGGGG - Intronic
948793847 2:240392292-240392314 CAGGCAGGAGGGGCTGTAGGAGG - Intergenic
1169286935 20:4316851-4316873 AAGGGAAGAGAGTGTGAAAGAGG + Intergenic
1169314054 20:4573338-4573360 AAGGCAAGAGACTCTGAAACAGG - Intergenic
1169628784 20:7601377-7601399 CAGGAGAGAGAGAGTGAAGGGGG - Intergenic
1169636442 20:7697179-7697201 CAGGAAACAGAGTGTGAAGGGGG + Intergenic
1169929641 20:10818575-10818597 CAGGCAAGAGAGTGTGCAGAGGG + Intergenic
1170414130 20:16122022-16122044 CAGGGAAGAGTGTATGAAGCTGG + Intergenic
1170741966 20:19066105-19066127 CAGGCAAGAGAGAACCAAGGTGG - Intergenic
1171210858 20:23315858-23315880 CAAGCAACAGAGTCTGAAGCTGG + Intergenic
1171307695 20:24120196-24120218 TATGCAAGAGAAGCTGAAGGAGG + Intergenic
1171399727 20:24865043-24865065 CAGCCAAGAGTGAATGAAGGAGG - Intergenic
1172036103 20:32011776-32011798 CAAGCCAGAGGGACTGAAGGAGG + Intronic
1172045160 20:32074886-32074908 CAGGGAAGAGAGGCTAAAGTGGG + Intronic
1172759464 20:37311864-37311886 CGGGCAGGAGAGTCTGTGGGAGG + Intronic
1172783260 20:37449864-37449886 CATGCAACAGAGAATGAAGGTGG - Intergenic
1173285607 20:41669086-41669108 CAACCAACAGAGACTGAAGGCGG + Intergenic
1174412206 20:50343561-50343583 CAGGCAGGAGGCTCTGAAGGAGG + Intergenic
1174664984 20:52249543-52249565 CAGGAGAGAGAGACTGAAGGGGG - Intergenic
1175013719 20:55765836-55765858 CAGGAGAGAGAGCATGAAGGAGG + Intergenic
1175027998 20:55923340-55923362 CAGGTGAGAGAGAGTGAAGGAGG - Intergenic
1178046287 21:28697636-28697658 CTGGCAAGAGAGAAAGAAGGTGG - Intergenic
1181079009 22:20401488-20401510 CAGGCAGGAGGGTCTGGCGGGGG - Intronic
1183538769 22:38417777-38417799 GAGGCGAGTGAGGCTGAAGGGGG - Intergenic
1183754481 22:39747357-39747379 GAGGCAAGGGAATCTGAAAGAGG + Intronic
1183776835 22:39971617-39971639 CAGCCAAGCGAGTCTGAGCGGGG + Exonic
1184437964 22:44491004-44491026 CAGCTAAGAAAATCTGAAGGGGG + Intergenic
1184563462 22:45276877-45276899 CAGGCATGAAAGTGTGGAGGGGG + Intergenic
1185026522 22:48417333-48417355 CATGCACGAGGGGCTGAAGGGGG + Intergenic
1185132133 22:49045226-49045248 CCTGCCAGAGAGGCTGAAGGAGG - Intergenic
1185186402 22:49403281-49403303 CCAGAGAGAGAGTCTGAAGGGGG - Intergenic
949203233 3:1406295-1406317 CAGGCAAGAGAGTGTGTATAGGG + Intergenic
949261279 3:2105517-2105539 CAGGCAAGAGACAGTGAAGGAGG + Intronic
950171958 3:10844865-10844887 CAGGGAAGAGAAACTGGAGGAGG + Intronic
950520396 3:13494719-13494741 CCGGCAAGGGCGGCTGAAGGCGG - Intronic
952005590 3:28838820-28838842 GAGGCAAGAGAGGCTGGAGTGGG + Intergenic
952289640 3:32002988-32003010 CAGGGAAGACTGTCTGCAGGAGG + Intronic
952401087 3:32964949-32964971 CAGGCAAGAGAGTGTGTGCGGGG - Intergenic
952749525 3:36814168-36814190 AAGGCAACAGAGTCTGATAGGGG + Intergenic
953781272 3:45872890-45872912 AAGGCAAGTGAGGCTGAAGTAGG + Intronic
956222721 3:66921869-66921891 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
956363366 3:68472270-68472292 CAGGCAAGAGAGTTTGTATGGGG - Intronic
958504320 3:94954679-94954701 CAGGGAAGACAGGTTGAAGGTGG + Intergenic
958636875 3:96755970-96755992 CAGGAAAGAGAATTTGAAAGAGG + Intergenic
958678284 3:97293871-97293893 CAGGCCGGGGAGGCTGAAGGTGG - Intronic
958841211 3:99208189-99208211 GAGGCAAGAGAGGCAGAAAGGGG - Intergenic
960013674 3:112861068-112861090 CAAGCAAGAGAGAGTGGAGGGGG - Intergenic
960948943 3:122986539-122986561 AAGGCAAGAGAGGCAGGAGGGGG + Intronic
961473175 3:127131147-127131169 ACGGCAACAGAATCTGAAGGGGG - Intergenic
964271320 3:154959358-154959380 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
965233839 3:166090296-166090318 CAGGAAAGGGAGAGTGAAGGGGG + Intergenic
965389212 3:168084166-168084188 CAGGAGAGAGAGGGTGAAGGGGG - Intronic
965812871 3:172609955-172609977 CAGGCAAGAGAGTGTGTGCGGGG - Intergenic
965865209 3:173197330-173197352 CAGGAGAGAGAGAATGAAGGAGG + Intergenic
965872436 3:173278186-173278208 GAGGCAAGAGGGACTGGAGGAGG - Intergenic
966477421 3:180366445-180366467 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
966834427 3:184038383-184038405 CAGGCAAGGGGGTCTGCATGAGG - Exonic
967207007 3:187133090-187133112 CATGGAAGAGAGACTGAAAGTGG - Intronic
967849136 3:194069449-194069471 CAGTCTAGAGAGACTCAAGGAGG - Intergenic
968080881 3:195846292-195846314 CAGGCCAGGGTGTCTGTAGGAGG - Intergenic
968695311 4:2022334-2022356 CAGCGAAGAGAGATTGAAGGGGG - Intronic
968712372 4:2128298-2128320 GAGTCAGGAGAGTCTGAGGGTGG - Intronic
968799815 4:2734605-2734627 CAGGCCAGATAGTTTGCAGGAGG + Intergenic
969072000 4:4547036-4547058 CAGGAAAGAGAGAGTGAAGGGGG - Intergenic
969858258 4:10017103-10017125 CAGGGAAGACAGCCTGGAGGAGG - Intronic
970663445 4:18311484-18311506 CAGGCAAGAGAGTGTGTGTGGGG + Intergenic
972730651 4:41791605-41791627 CAGGCTAGGGAATCTAAAGGTGG - Intergenic
973832024 4:54771336-54771358 CAGGCCAGTAAGTCTGGAGGAGG + Intergenic
974066786 4:57086143-57086165 CAGGCAAGAGAGCATGCAGAGGG + Intronic
974608620 4:64185366-64185388 CAGGAGAGAGAGAATGAAGGGGG + Intergenic
974771684 4:66423014-66423036 AAGGAAAGAGAAACTGAAGGGGG + Intergenic
975349314 4:73328273-73328295 AAGGTAAAATAGTCTGAAGGTGG - Intergenic
976150250 4:82084388-82084410 CAGGCAAGAGAGCTTGAATAAGG + Intergenic
976244092 4:82990154-82990176 CAGGCATGGCATTCTGAAGGAGG - Intronic
977433153 4:96957623-96957645 CAGGCAAGAGAGTGTGTGGAGGG - Intergenic
978219776 4:106256354-106256376 CAAGGGAGGGAGTCTGAAGGGGG - Intronic
978391278 4:108228119-108228141 CAGGAGAGAGAGAGTGAAGGAGG + Intergenic
978420134 4:108523454-108523476 CAGGAAAGAGACTCGGAAGCAGG + Intergenic
978684537 4:111423694-111423716 CAGGAAACAGAGTTTGAAGTTGG - Intergenic
979437013 4:120705094-120705116 CAAGCAAGAGAGTATGAAACTGG + Intronic
979990881 4:127374020-127374042 CAGGCGAGAAAGAGTGAAGGGGG + Intergenic
981033728 4:140151175-140151197 CGGGCAAGAGTGGCTGGAGGAGG + Intronic
983048017 4:163010415-163010437 CAGGCAAGAGAGTATGTACAGGG + Intergenic
983794396 4:171842629-171842651 GAGGCAAGAGAGAGAGAAGGAGG + Intronic
983830652 4:172322626-172322648 CAGGAGAGAGAGCGTGAAGGTGG + Intronic
983874574 4:172861767-172861789 CAGGCAAGAGAGTGTGTACGGGG - Intronic
984028804 4:174577242-174577264 CAGGCAAGAGAGTGTGTGTGTGG - Intergenic
985177506 4:187216994-187217016 CAGGAAAGAGAGAGTGAGGGAGG + Intergenic
985830197 5:2222419-2222441 CAGGCGAGTGGCTCTGAAGGAGG - Intergenic
986786483 5:11118962-11118984 GAGCCAAGAGAGTGTGAAGGGGG - Intronic
986846551 5:11763097-11763119 CAGGAGAGAGAGAGTGAAGGAGG - Intronic
987749619 5:22022342-22022364 CAGGAGAGAGTGTGTGAAGGAGG - Intronic
987967775 5:24897650-24897672 CAGGAGAGAGAGAGTGAAGGAGG - Intergenic
988143778 5:27277427-27277449 CAAGCAAGAGACTTGGAAGGAGG + Intergenic
989063990 5:37441176-37441198 GAGGCAAGTGAGTTTGTAGGTGG + Intronic
990465672 5:56068862-56068884 CAGGAAAGAGATTCTGACCGTGG - Intergenic
991975987 5:72184064-72184086 CAGGCAAGGGAGTATGAATTTGG + Intronic
993831999 5:92771401-92771423 GAGGCAAGAGAGTCAGATGATGG - Intergenic
994417800 5:99497006-99497028 GAGGCAAGTGAGTTTGTAGGTGG + Intergenic
994462165 5:100078150-100078172 GAGGCAAGTGAGTTTGTAGGTGG - Intergenic
996985150 5:129552999-129553021 CAGGCAAGAGAGTCAACAGTAGG - Intronic
997040818 5:130251345-130251367 TGGGCATGAGAGTCTTAAGGAGG + Intergenic
997236866 5:132277454-132277476 TTGGCAAGAAAGTCTGAAGACGG - Intronic
997503604 5:134398111-134398133 AAGGCAAATGAGGCTGAAGGGGG + Intergenic
999204643 5:149839421-149839443 CAGGCAAGGAAGGCTGCAGGTGG + Intronic
999273111 5:150309517-150309539 CAGGCAAGGGAGCCTCAAGGAGG - Intronic
999296276 5:150461435-150461457 CAGGCAAGACAGTCATGAGGAGG - Intergenic
999361787 5:150991888-150991910 CAGGAAAGAGTGGGTGAAGGGGG + Intergenic
999481134 5:151949171-151949193 CAGGCAAGACTTCCTGAAGGAGG + Intergenic
1000741765 5:164977060-164977082 AAGTCAAGGGAGGCTGAAGGAGG - Intergenic
1001415118 5:171540192-171540214 CAGGGAAGACAGCCTGGAGGAGG - Intergenic
1001938655 5:175725761-175725783 CAGGCAAGAGAGTCTGTGCAGGG + Intergenic
1002206072 5:177563503-177563525 CAGGCAAGAATGGCTGGAGGAGG - Intergenic
1002589785 5:180282543-180282565 CTGGCAAAAGAGTCTGAGGGCGG - Intronic
1002822787 6:742871-742893 CAGAAAAGAGAGCCTGAAAGAGG - Intergenic
1002918514 6:1548326-1548348 GAGGCAAGAGTGTATAAAGGAGG - Intergenic
1003024741 6:2544134-2544156 CAGGCAAGAGAGTTTGTACAGGG + Intergenic
1003095090 6:3136226-3136248 CAAGCAAGACAGTGTGAAGATGG - Intronic
1003136696 6:3439810-3439832 GAGCCAAGAAGGTCTGAAGGAGG + Intronic
1003219288 6:4143420-4143442 CAGGAGAGAGAGAATGAAGGGGG + Intergenic
1004797526 6:19104007-19104029 CTGGCTAGAGATTCTGGAGGAGG - Intergenic
1004864933 6:19844284-19844306 CTGGGAAGAGACTCTTAAGGGGG - Intergenic
1005890922 6:30137084-30137106 CTGCCAGGAGAGCCTGAAGGAGG + Exonic
1006626432 6:35401286-35401308 CTGGCAAGGGAGTCGGCAGGAGG - Intronic
1006719192 6:36139087-36139109 CAAGGAAGAGAGGCTGCAGGCGG - Intronic
1007068327 6:39015538-39015560 CAGGAGAGAGAGAGTGAAGGAGG - Intronic
1007944151 6:45810334-45810356 CAGGAAAGAGAGTGTCAAGGAGG - Intergenic
1008579164 6:52890217-52890239 CAGGCAAGAGAGTGTGTACAGGG - Intronic
1008850323 6:56014968-56014990 CAGGCAAGAGGGAATGAAGGAGG + Intergenic
1009241746 6:61193621-61193643 CATGGGAGAGAGGCTGAAGGGGG - Intergenic
1009345680 6:62610952-62610974 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
1010451820 6:76012573-76012595 GAGGCAAGAGAGACTGAGGAAGG + Intronic
1010517777 6:76794222-76794244 CAGGCAAACAAGTCTGGAGGGGG - Intergenic
1011219009 6:85034542-85034564 CAGGCAAGAGAGAGTGAAGGGGG + Intergenic
1011551456 6:88534575-88534597 CAGGAAAGAGAGAATGAAGGGGG + Intergenic
1012091946 6:94909360-94909382 AAGGAAAGAGAGAATGAAGGAGG - Intergenic
1012436564 6:99220797-99220819 CAGGCAAGAGAGACCAAAGCAGG + Intergenic
1012599571 6:101078546-101078568 AAGGCAAGTGAGGCTGAATGAGG + Intergenic
1012968418 6:105700541-105700563 CAGGCAAGAGAGACTGAGCAGGG - Intergenic
1014766209 6:125409598-125409620 CAGGCAAGAGACACTGTACGGGG - Intergenic
1014908268 6:127057357-127057379 CAGGCAAGAGAGTTTGTGGAGGG + Intergenic
1015347141 6:132174004-132174026 CAGGAGAGAGAGACGGAAGGGGG + Intergenic
1015464086 6:133528579-133528601 CAGGGGAGAGAGTTTAAAGGCGG - Intronic
1016139305 6:140587937-140587959 CAGGAAAAAGAGTGTGAAGGAGG + Intergenic
1017629281 6:156380749-156380771 CAGGCCAGTGGTTCTGAAGGTGG + Intergenic
1017631825 6:156403446-156403468 CAGGAGAGAGAGAGTGAAGGGGG - Intergenic
1019739784 7:2666855-2666877 CAGCCAAGAGAGACTGCTGGAGG + Intergenic
1021377923 7:19931833-19931855 CAGGCAAGAGAGTTTGTGTGTGG + Intergenic
1022561289 7:31352576-31352598 CAGGCAAGAGAGAGTGAAGGGGG - Intergenic
1023212478 7:37822528-37822550 CAGGGAAGAGAGTGTTCAGGGGG - Intronic
1023552927 7:41388640-41388662 CAGGGAAGAGAGTATGGAGAGGG - Intergenic
1024702244 7:51916742-51916764 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
1027929198 7:84509252-84509274 CAGGCAAGAGTGTGAGCAGGAGG - Intergenic
1028419656 7:90618597-90618619 CAGGCAAGGGAAGATGAAGGGGG + Intronic
1028884338 7:95914099-95914121 CAGGCAAGAAGGCCTGAATGGGG + Intronic
1029861565 7:103577931-103577953 CAGGTGAGAGAGCCTGAAGCTGG - Intronic
1029914074 7:104188875-104188897 CAGGAGAGAGAGCATGAAGGGGG - Intronic
1030167658 7:106571198-106571220 CAGGCAAGAGTGTGTGTGGGGGG - Intergenic
1030924011 7:115428674-115428696 AAGGCAAGAAACTCTGAATGAGG + Intergenic
1031316020 7:120258041-120258063 CAGGAGAGAGAGAGTGAAGGGGG - Intergenic
1032874905 7:136027819-136027841 CAGGCAAGGGAGTCTGAGCAGGG - Intergenic
1032962452 7:137052418-137052440 CAGGCAAGAGAGTCTGTGCAAGG - Intergenic
1033367436 7:140682425-140682447 CTTGGAAGAGAGTTTGAAGGAGG + Intronic
1033367568 7:140683400-140683422 GAGGCAGGGGAGTCAGAAGGTGG + Intronic
1034020820 7:147640727-147640749 CAGGCAAGAAAGAAGGAAGGAGG + Intronic
1034349054 7:150404952-150404974 CAGGAAAGAGGGTCGGACGGAGG - Intronic
1036100909 8:5783645-5783667 CAGGCAAGAGAGTCTGTGCAGGG - Intergenic
1037125360 8:15341602-15341624 CAGGAGAGAGAGAGTGAAGGGGG - Intergenic
1038334303 8:26634130-26634152 CAGGCTAGAAACTCTGAGGGCGG - Intronic
1038704024 8:29877316-29877338 CAGGAAAGAAAGAGTGAAGGGGG + Intergenic
1039772031 8:40697152-40697174 CTGGCAACTGCGTCTGAAGGAGG + Intronic
1040864954 8:52039448-52039470 CAGGCAGGAGATTATGCAGGTGG - Intergenic
1041674800 8:60527142-60527164 CAGGAAAGAGAGAGTGAAGGGGG + Intronic
1042775380 8:72424914-72424936 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
1042971226 8:74411074-74411096 CAGGAAAGAGAGAGTGAAGGAGG - Intronic
1043946015 8:86253439-86253461 CAGGGAACAGAGTCCCAAGGTGG + Intronic
1044276966 8:90312478-90312500 CAGGAGAGAGAGAGTGAAGGGGG - Intergenic
1044480972 8:92687632-92687654 CATGAAAGAGAGTGTGAAGGGGG - Intergenic
1046335400 8:112780550-112780572 AAGGAAAGAGACACTGAAGGGGG + Intronic
1046426731 8:114061982-114062004 CAGGCAAGAGAGCCTGTGAGGGG - Intergenic
1047692060 8:127366053-127366075 CAGGCAAGAGAGACCTAAGCTGG + Intergenic
1047748654 8:127864123-127864145 CAGGCCAGAGAAGCTGCAGGTGG + Intergenic
1048598043 8:135887541-135887563 CAGGAGAGAGAGAGTGAAGGGGG - Intergenic
1048689911 8:136950599-136950621 CAGGAAAGAAAGAGTGAAGGGGG + Intergenic
1049148338 8:141018424-141018446 CAGGAAAGTGAGGCTGAAGAGGG - Intergenic
1049544246 8:143222002-143222024 CAGGGGACAGAGGCTGAAGGGGG - Intergenic
1049763012 8:144339237-144339259 CAGCTAGGAGAGGCTGAAGGAGG + Intergenic
1050233040 9:3548805-3548827 CAGGCTAGGGAGTATGCAGGAGG + Intergenic
1050243436 9:3661576-3661598 CAGACGAGAGAGTCTGAGGAGGG - Intergenic
1051264584 9:15298509-15298531 CAGGCAAGAGAGTGTGTGCGGGG + Intronic
1051525123 9:18034366-18034388 CAGAGAGGAGAGTTTGAAGGAGG - Intergenic
1051930296 9:22377121-22377143 CAGGGATGAGATTCTGAGGGAGG - Intergenic
1052571806 9:30235123-30235145 CAGGAGAGAGAGCGTGAAGGGGG + Intergenic
1053340114 9:37318814-37318836 GAGGCAGGAGAATCTGAAGTGGG + Intronic
1055073063 9:72187388-72187410 CAGGCAAGAGCATGTGAAAGAGG - Intronic
1055435045 9:76284403-76284425 CAGGCAAGAGAGTGTGTGCGGGG - Intronic
1055654774 9:78441149-78441171 CAGCCAAGAGAGGCGGAAGAGGG - Intergenic
1057298326 9:93862024-93862046 CAGGCAAGACAGTTTTCAGGTGG - Intergenic
1057405896 9:94770499-94770521 CACGCGAGTGAGTCTGAAAGAGG - Intronic
1057973213 9:99576945-99576967 CAGGCAAGAGACTATGGATGAGG + Intergenic
1058929039 9:109700332-109700354 CAGGCAAGAGAGTATGTGGAGGG - Intronic
1059054197 9:110961749-110961771 CAGGCAAGAGAGTGTGTACAGGG + Intronic
1059459163 9:114418793-114418815 CAGGCAAGGGAGACTGGAGAGGG - Intronic
1061035984 9:128114651-128114673 CAGGCCCGAGAGGATGAAGGCGG - Intergenic
1061861399 9:133470350-133470372 CAGGCAAGCCAGGCAGAAGGGGG - Exonic
1061891653 9:133624633-133624655 CAGGAGAGAGAGAGTGAAGGAGG + Intergenic
1185483930 X:468183-468205 CAGGCTGGAGGCTCTGAAGGAGG - Intergenic
1187905483 X:24061979-24062001 CAGGCAACAGAGGATGAAGCAGG + Intronic
1187931490 X:24297408-24297430 CAGGCAAGAGAGCGTGAGGAGGG + Intergenic
1188446298 X:30256425-30256447 GAGGGCAGAGAGTCTGATGGAGG + Intergenic
1189397059 X:40632327-40632349 CAGTCCTGAGAGTCTGCAGGGGG - Intronic
1191770165 X:64747038-64747060 GGGGCAAGAGAGAGTGAAGGGGG + Intergenic
1192289672 X:69780714-69780736 CAGGAAAGAGAGAGTGAAGGGGG - Intronic
1193998013 X:88390654-88390676 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
1194019207 X:88666241-88666263 CAGACAAGAGTTTCTGCAGGTGG + Intergenic
1194458129 X:94129935-94129957 AAGGCAAGAGAGTCAGAACATGG + Intergenic
1196004785 X:110824017-110824039 CAGGCAAGAAATTGTGAAAGAGG - Intergenic
1196371047 X:114980277-114980299 CAGGCAAGAGAGTGTGTATAGGG + Intergenic
1197366644 X:125572132-125572154 CAGGAAAGGGAGAATGAAGGGGG + Intergenic
1197902779 X:131392147-131392169 CAGGAAAGAGAGTGGGGAGGGGG - Intronic
1198111025 X:133502707-133502729 CATGCAAGAGAGTCGGAATGGGG - Intergenic
1198276987 X:135104266-135104288 GAAGCAAGAGAGAGTGAAGGAGG - Intergenic
1198320177 X:135512625-135512647 GAGGCAAGAGAGGCAGAAGCTGG + Intergenic
1198560182 X:137841165-137841187 TGGGCAAGAGAGTCTGCTGGAGG + Intergenic
1198581355 X:138068165-138068187 CATGCAAGAGAATCTGAACTAGG + Intergenic
1199093356 X:143715349-143715371 CAGGAAAGAGTGGGTGAAGGGGG - Intronic
1199185291 X:144909265-144909287 CAGGCCAGAGTTTCTAAAGGTGG - Intergenic
1199214979 X:145252817-145252839 CAGGAAAGAGTGGGTGAAGGGGG + Intronic
1199357035 X:146874757-146874779 CAGGCAAGAGAGTGTGAGCAAGG - Intergenic
1199859962 X:151792569-151792591 CAGCTCAGAGAGTCTCAAGGTGG - Intergenic
1199996428 X:153029409-153029431 GAGGCAAGAGAGTCAGATGAGGG + Intergenic
1200888880 Y:8300183-8300205 CAGGAAAGAGAGTGTAAAGGGGG - Intergenic
1201419875 Y:13786898-13786920 CAGGCAAGAGAGTGTGTGTGGGG + Intergenic
1201579039 Y:15492075-15492097 CAGGCAGGAGAGCAGGAAGGTGG + Intergenic
1201856622 Y:18551621-18551643 GAGGAGAGAGAGTGTGAAGGAGG + Intronic
1201876699 Y:18768759-18768781 GAGGAGAGAGAGTGTGAAGGAGG - Intronic
1201908418 Y:19108145-19108167 CAGGCCAGCTAGTCTGAAGAGGG + Intergenic
1202100412 Y:21302490-21302512 CAGGAAAGAGAGTGTAAAGGGGG + Intergenic