ID: 909937194

View in Genome Browser
Species Human (GRCh38)
Location 1:81565753-81565775
Sequence TCTGGGCCACTAAAGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909937194_909937197 18 Left 909937194 1:81565753-81565775 CCTTTCTTCTTTAGTGGCCCAGA 0: 1
1: 0
2: 0
3: 19
4: 170
Right 909937197 1:81565794-81565816 TTTTCCCATTAGAAATGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909937194 Original CRISPR TCTGGGCCACTAAAGAAGAA AGG (reversed) Intronic
902042631 1:13503828-13503850 TATGGGCCATTGAAGATGAAGGG - Intronic
902208193 1:14885241-14885263 GCTGGGCCACGAAAGAAGGATGG - Intronic
903651475 1:24925129-24925151 TCTGGGCCACTTTAGGAGATGGG - Intronic
903858597 1:26351947-26351969 TCTGGGGCCCTGCAGAAGAAAGG - Intronic
904580059 1:31536371-31536393 TCTGGACCTCTACAGAAGAGAGG + Intergenic
906860808 1:49357138-49357160 GCTGGGCCAACAAAGAAGACTGG + Intronic
906929975 1:50159748-50159770 TCTAAGCCAGTAGAGAAGAATGG + Intronic
907579013 1:55555287-55555309 CCTGGGCCACAAAAGAAGAGGGG - Intergenic
908991526 1:70096828-70096850 TCTGGGCCATAAAATGAGAATGG + Intronic
909195438 1:72615706-72615728 TCTGGGCCACTAACGCACTATGG - Intergenic
909584347 1:77272493-77272515 TATGTGCCACTAAAAAAGAATGG + Intergenic
909589432 1:77329401-77329423 TCTGGTTCAATAAAGCAGAATGG + Intronic
909937194 1:81565753-81565775 TCTGGGCCACTAAAGAAGAAAGG - Intronic
910446827 1:87306874-87306896 TCTGAGCCATTAAAAAAAAAAGG - Intergenic
914249947 1:145913737-145913759 TCTGGGCCTCTAAAGGAATAGGG - Intronic
915149581 1:153819727-153819749 TCTGGCTCACTAGACAAGAAAGG + Exonic
916821272 1:168401085-168401107 TCTGGGCCAGTGAAGATGGAAGG + Intergenic
920068083 1:203283179-203283201 GCTGGGCCATTAAAAATGAATGG + Intergenic
921165044 1:212500828-212500850 TCTGGGCAGGCAAAGAAGAAAGG - Intergenic
921246714 1:213251071-213251093 CCTGGGCGAATAAAGAAGACAGG - Intronic
923010557 1:230084431-230084453 TCTGGGCAACCAAAGGAGGAGGG + Intronic
923050301 1:230387000-230387022 TCCGGGCCCCTAAAGTAGCAGGG - Intronic
924147630 1:241092959-241092981 TCTTGGCAACTACAGAAAAAAGG + Intronic
924441528 1:244089514-244089536 TCTGGGCCACCAAGGAGAAAGGG - Intergenic
924493253 1:244560726-244560748 TCTGGCAAACTTAAGAAGAATGG - Exonic
1064205129 10:13316838-13316860 TCTGGGCCACTATACAATACTGG + Intergenic
1064651515 10:17514606-17514628 TCTGGGCCTCTGGAGAAGACAGG + Intergenic
1065535658 10:26712657-26712679 TCCATGCCACTTAAGAAGAAGGG + Intronic
1068652201 10:59534841-59534863 TCTAAGCCACTAAAGTATAAAGG - Intergenic
1069816473 10:71198333-71198355 TCTTAGACACTACAGAAGAAAGG + Intergenic
1070978592 10:80626397-80626419 TCTGGTTGACAAAAGAAGAATGG + Intronic
1072534946 10:96355431-96355453 TCTTGGCCCCAAAAGAAGGAAGG + Intronic
1072651887 10:97302400-97302422 TCTGGGCCACAACAGAGCAAAGG + Intergenic
1073065683 10:100757858-100757880 TATGGGAAGCTAAAGAAGAATGG + Intronic
1077355807 11:2116251-2116273 CCTGGGGCACTCAAGAACAATGG + Intergenic
1081937427 11:46914971-46914993 TCTGGGCCAGCAAAGAACACAGG - Intronic
1082639321 11:55637404-55637426 TCTTTGCCAATAAATAAGAAAGG - Intergenic
1084586319 11:70064865-70064887 TCGGGGCCATCACAGAAGAATGG + Intergenic
1085687035 11:78632921-78632943 TCTGAGCCACAGAAGGAGAAGGG + Intergenic
1088707140 11:112474212-112474234 TCTGGAGCACAAAAGAAGGAAGG - Intergenic
1092148104 12:6228726-6228748 TCTGGGCCAGTACAGAAGGCTGG - Intronic
1092182304 12:6454082-6454104 TATGGGGCACAGAAGAAGAAAGG + Intronic
1093933475 12:24977323-24977345 GCTCTGCCACTAAGGAAGAAAGG + Intergenic
1094087917 12:26614144-26614166 TCTGGGCCCATAGAAAAGAAAGG + Intronic
1096416766 12:51421368-51421390 TCTGGGGCACTGCAGAAGACAGG - Intronic
1101372381 12:104141145-104141167 GCGGGGCTACTTAAGAAGAAGGG - Intergenic
1102446091 12:113003840-113003862 TCTGTGCAACTAGAGAAGAGGGG + Intronic
1102945057 12:116979503-116979525 ACTGGCCCAATAAAGGAGAAGGG - Intronic
1103455904 12:121065051-121065073 TCTGGGTCACAAAATAAGACTGG + Intergenic
1113564192 13:111308753-111308775 TCTGGGCAGCCAAAGGAGAAGGG + Intergenic
1115193540 14:30772291-30772313 TCTTGAACACTAGAGAAGAAAGG - Intergenic
1116954015 14:50904982-50905004 TGTGGGCCACTAAAACAAAATGG - Intronic
1118264588 14:64282709-64282731 GATGGACCACTAAAGGAGAAAGG + Exonic
1118737771 14:68714465-68714487 ATTGGGCCACCAAAGCAGAACGG + Intronic
1118870065 14:69734069-69734091 TCTAGGCAACTAAGGGAGAAAGG - Intronic
1120130216 14:80797989-80798011 TCTCAGCCACTAAAGCAGAATGG + Intronic
1122753684 14:103959423-103959445 TCTGGAGCACTGAAGAAGTAAGG + Intronic
1129511123 15:76123530-76123552 TCTGGGTCCCTAAACAAGACTGG - Intronic
1130067386 15:80615975-80615997 GCTGGGCTAGTGAAGAAGAAGGG - Intergenic
1130785858 15:87095383-87095405 TTTGTGCCACCAAAGAACAAGGG - Intergenic
1130984576 15:88836656-88836678 GCTGGAGCACCAAAGAAGAAAGG + Intronic
1131190716 15:90314541-90314563 TCAGGGCCACTAAATATGATTGG + Intergenic
1134386843 16:13781288-13781310 TCTGGGCTACTCAGGAGGAAGGG + Intergenic
1134638111 16:15808084-15808106 CCTGGGCTAGTAAAGAAGAAAGG + Intronic
1135390799 16:22091844-22091866 TCTTGACCACTATAAAAGAAGGG + Intergenic
1136576236 16:31127013-31127035 TCTGGGCCAGGAAAGAAAAGTGG - Exonic
1138902639 16:61292792-61292814 CTTGGGCCATTAAAGAAAAATGG - Intergenic
1139151431 16:64386704-64386726 TCTGAGACATTGAAGAAGAAAGG + Intergenic
1140056399 16:71529756-71529778 TCTGGGCCACTATAGCTTAAGGG - Intronic
1140315137 16:73889131-73889153 TCTATGCCAATAAAGAAGAAAGG - Intergenic
1142211869 16:88812260-88812282 TCTCGGCCAATAAAGGAGAAAGG - Intergenic
1142221657 16:88857784-88857806 TGTGGGCCAGTAAAGAGGATGGG - Intronic
1142882072 17:2889606-2889628 TCTGGGACATTAGAAAAGAAAGG - Intronic
1143388161 17:6544218-6544240 TCTGTGCCTCAGAAGAAGAAAGG + Intronic
1143988618 17:10937447-10937469 TCTGAGTGATTAAAGAAGAATGG + Intergenic
1144635731 17:16907743-16907765 TCTGGGCCACTCAAGATGTCAGG - Intergenic
1147401225 17:40181048-40181070 TCTGGGCCCCTAAAGGACACAGG + Intronic
1149189576 17:54043314-54043336 TCTGTGCCCCAAAAGAGGAAAGG + Intergenic
1152255745 17:79238496-79238518 CCTGGGCCAGTAGAGGAGAAGGG - Intronic
1152376109 17:79919828-79919850 CCTGGGCCCCTAGAGTAGAAAGG + Intergenic
1153222630 18:2875192-2875214 CTTGGGCCATTAAAAAAGAAAGG + Intronic
1153410204 18:4783816-4783838 TCATGGCCCCTAAAGATGAAGGG - Intergenic
1156160763 18:34355321-34355343 TCTGGGCATCCAATGAAGAAAGG - Intergenic
1156418536 18:36925322-36925344 TATGAGCCAAGAAAGAAGAAGGG + Intronic
1156625973 18:38909535-38909557 AATGGGCCACCTAAGAAGAATGG + Intergenic
1157148435 18:45190184-45190206 TTTAGCCTACTAAAGAAGAAAGG - Intergenic
1157365932 18:47064373-47064395 TGTGGGCCACCTAAGAAGCAGGG + Intronic
1158286997 18:55894697-55894719 TCTAGGGCACTGAAAAAGAATGG - Intergenic
1159917639 18:74200858-74200880 CCAGGGCCACAAAAGGAGAAGGG - Intergenic
1159958047 18:74533692-74533714 TCTGACCCACCAAAGAAGAAAGG + Intergenic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1163999912 19:21088955-21088977 TCTGGACCACTTAGGAAGTATGG - Intronic
1165638252 19:37362285-37362307 GCTTTGCCACTAAAGCAGAATGG - Exonic
1167226820 19:48249839-48249861 TCTTGGTCACTTGAGAAGAAAGG + Intronic
1168118487 19:54239505-54239527 TCTGGGACACTAGGAAAGAAGGG - Intronic
926211637 2:10875193-10875215 TCTGGGCCAGTACAGCTGAAAGG - Intergenic
927141707 2:20135430-20135452 TCTGGGGCAGTTCAGAAGAAAGG + Intergenic
928728350 2:34202156-34202178 TCTGGGCCACCACAGAAGGAAGG - Intergenic
932311041 2:70741406-70741428 TCTGGGAGAATAAAGGAGAAAGG + Intronic
935333932 2:101997719-101997741 TAAGGGGCACTAAAGAAGAATGG - Intronic
938607615 2:132912011-132912033 TCTGAGCCATTAAAGAAAACTGG + Intronic
940645813 2:156391937-156391959 TCAGGACCAGAAAAGAAGAAAGG + Intergenic
941659188 2:168177905-168177927 TCTGGGCAAATAAAGACAAAAGG + Intronic
947697380 2:232203225-232203247 TCTGGGTCAATGATGAAGAATGG - Intronic
1171046756 20:21815648-21815670 TCTGGGCCACTAGAGAATGAGGG - Intergenic
1173175467 20:40761807-40761829 TCTGGGCCACTAAATCTGATGGG - Intergenic
1177194860 21:17893165-17893187 TCTGGGACACCAAAAGAGAATGG + Intergenic
1178245549 21:30948010-30948032 TCTGGGCCACTGAAGATTATTGG - Intergenic
1179711868 21:43268178-43268200 TCAGGACCACTAAGGGAGAAGGG - Intergenic
1179730103 21:43362952-43362974 TCTGAGCCCCTTGAGAAGAAAGG + Intergenic
1180643191 22:17316342-17316364 TCTGGGCAACAAAAGGACAAAGG - Intergenic
1181684577 22:24519743-24519765 TCAGGGCCAGTAAACAAGAAAGG - Intronic
1182447164 22:30396726-30396748 TCTGGGCCTCTGAACAAGGAGGG - Intronic
1183592298 22:38786854-38786876 TCAGTGCCACAAAAGAACAAGGG - Intronic
953043120 3:39272512-39272534 TCTGGCCACCTAAAGAAGAAGGG - Intronic
953335156 3:42088354-42088376 TGTGGGCCACTTAACAAAAAGGG - Intronic
953955429 3:47228114-47228136 TCTGAGCCAGTGAAGAAGACAGG - Exonic
954754015 3:52829279-52829301 TCTGGACCAGCAAAGAAGAAGGG + Exonic
955207321 3:56908092-56908114 GCTGGGCAACAAAAGGAGAAAGG + Intronic
956399370 3:68860961-68860983 TCTGGGACTCTAAAGTGGAATGG + Intronic
956585634 3:70861486-70861508 TCTGGACCACTAAGGAAGTCTGG + Intergenic
960921434 3:122750714-122750736 TGTGGGGCACTAAAGGAGAAAGG + Intronic
964308578 3:155367891-155367913 TTTGGGGCCCTCAAGAAGAAAGG + Intergenic
967882145 3:194309103-194309125 TCGGGGGCAAAAAAGAAGAAAGG - Intergenic
967942431 3:194776574-194776596 TCTGGGCCAGTGGAGAAAAATGG - Intergenic
969229345 4:5818977-5818999 TCTGGACCACTGAATCAGAAGGG + Intronic
972783574 4:42306871-42306893 ACTGGGCCACTGGAGAAGGAAGG + Intergenic
977321635 4:95523341-95523363 ACTGGGCCAGTAAAGGAGATAGG + Intronic
977446881 4:97141831-97141853 TCCATGCCACCAAAGAAGAATGG - Intergenic
977564253 4:98565782-98565804 TCTAGGCCACTGAAAAAGGAGGG - Intronic
977737444 4:100434123-100434145 TCTAGACTAATAAAGAAGAAAGG + Intronic
979188242 4:117825257-117825279 TCTGGACCACTAGAAAAGAAAGG + Intergenic
979827832 4:125261414-125261436 TCTGGACACCAAAAGAAGAAAGG - Intergenic
980335875 4:131472678-131472700 TCTGTGATAGTAAAGAAGAATGG + Intergenic
981416508 4:144500085-144500107 TCTGGGCCACCAAAGCAACAAGG - Intergenic
985313809 4:188632546-188632568 TCTGTTCCACTTAAGAAGAAGGG + Intergenic
987439129 5:17933910-17933932 TCTGGGACACCAAAAAAAAAGGG - Intergenic
988683859 5:33509072-33509094 TCTGGACCACTAAGGAAGTCTGG + Intergenic
989494028 5:42090533-42090555 TCTGGGTCACTGAAGAAGACTGG - Intergenic
989550283 5:42726908-42726930 TCTGGGGCACTCGAGAAGAGTGG + Intergenic
991532351 5:67629654-67629676 TCCAGGCTATTAAAGAAGAAAGG - Intergenic
992673936 5:79086330-79086352 TCTGGACCACAAGAGAACAATGG - Intronic
993767436 5:91878670-91878692 TCTAGGCCACTAAAGATGTTGGG - Intergenic
996480331 5:123968743-123968765 CCTTGGACACTAAAGTAGAAAGG + Intergenic
998270346 5:140700759-140700781 TCTGGGCCCCTAGAGAAGCAGGG - Intronic
999017104 5:148118811-148118833 TCTGGCACAATAAAGAACAAGGG - Intronic
999501759 5:152153879-152153901 TCTGTGCAACTGAAAAAGAAAGG - Intergenic
1000475841 5:161706178-161706200 ACTGGGGCACAAGAGAAGAAAGG + Intergenic
1000886522 5:166753969-166753991 TCTGGCCCTCTATAGAAAAAGGG - Intergenic
1001922866 5:175614133-175614155 TCTGGCCCAATAATGAAAAAAGG - Intergenic
1008520669 6:52360202-52360224 CCAGAGCCACTAAATAAGAATGG - Intergenic
1013989614 6:116238316-116238338 TCAGAGCCTCTAGAGAAGAAAGG + Exonic
1014309612 6:119783406-119783428 CCTGGGGCACCAAAAAAGAATGG - Intergenic
1016382308 6:143497440-143497462 TGTGGGCCATTTAAGAAAAATGG + Exonic
1016404473 6:143716000-143716022 TGTAGGCCACTAGAGAAGACAGG + Intronic
1016452645 6:144198916-144198938 TGTGGGCCATTCAAGAAGAGAGG - Intergenic
1016499900 6:144708421-144708443 TCAGAGCCTCTAGAGAAGAAAGG - Intronic
1018423142 6:163657072-163657094 TGAAGGCCACTCAAGAAGAAAGG - Intergenic
1020043883 7:5025215-5025237 TGTGGACCACTAAAGAGCAAGGG - Intronic
1020245175 7:6424106-6424128 TCTGGGTCAGCAGAGAAGAACGG + Intronic
1021125191 7:16843991-16844013 TCTGGTCCGCTGAGGAAGAAAGG + Intergenic
1023690524 7:42781477-42781499 TGTGGGCTACATAAGAAGAATGG + Intergenic
1025839327 7:65129862-65129884 TCTGTGCCCCTAAAGAAGTCAGG - Intergenic
1025883741 7:65566103-65566125 TCTGTGCCCCTAAAGAAGTCAGG + Intergenic
1025887314 7:65609356-65609378 TCTGGGCCACTCTGGAAGAGGGG - Intergenic
1025889704 7:65636503-65636525 TCTGTGCCCCTAAAGAAGTCAGG - Intergenic
1026946861 7:74321908-74321930 TCTGGGGCACTTAACACGAATGG - Intronic
1028441097 7:90861711-90861733 ACTGGGAGACGAAAGAAGAAGGG - Intronic
1028460309 7:91084903-91084925 TCTGTGCCACTTCAGAAGTAGGG - Intronic
1029616047 7:101658176-101658198 TCTAGGCAAATAAAGAAAAAAGG - Intergenic
1036384257 8:8264637-8264659 ACGGGGGCACTAAGGAAGAAAGG - Intergenic
1039150562 8:34500375-34500397 TCTGGGCCATAAAATAACAAGGG + Intergenic
1043400831 8:79882605-79882627 ACTGGGCCACTAGAGAGGACAGG + Intergenic
1050620673 9:7449085-7449107 ACTGGGCCATGAAAGATGAATGG + Intergenic
1052118684 9:24681107-24681129 TATGGGCCACTAATTTAGAAAGG - Intergenic
1052278219 9:26702754-26702776 TCTAAACCACTTAAGAAGAATGG - Intergenic
1052465671 9:28826405-28826427 TCTGGCCCACTGAAGCAGAGTGG - Intergenic
1053031000 9:34777730-34777752 TCTGAGGCACTAGAGAAGCATGG - Intergenic
1056813546 9:89782823-89782845 TCTGGGACTCTAAGGAAAAAGGG + Intergenic
1060433452 9:123570859-123570881 TCTGGGCCTTTAAAGAAATATGG + Intronic
1062088782 9:134663188-134663210 TGTGGGCCAAGAAAGAAGAGAGG + Intronic
1188714896 X:33448964-33448986 TCTTGCCCAGTAAGGAAGAATGG - Intergenic
1189308465 X:40004738-40004760 TTTGGGCAACTAAAGAGAAATGG + Intergenic
1189387682 X:40550747-40550769 TCTGGGCCACTGCAAAGGAAAGG - Intergenic
1193020040 X:76781740-76781762 TCTGGGCCACTTAGGAGAAATGG - Intergenic
1193315161 X:80056389-80056411 TCTTGGCCACCTAAAAAGAATGG - Intergenic
1197847340 X:130817021-130817043 TCCAGGCTAATAAAGAAGAAAGG + Intronic
1198742484 X:139855915-139855937 TGTGGACCACTAAAGAGCAAGGG + Intronic
1199567124 X:149227303-149227325 GCTAGACTACTAAAGAAGAAGGG - Intergenic
1199665525 X:150093616-150093638 GCTGGGCCCTGAAAGAAGAAGGG - Intergenic