ID: 909939360

View in Genome Browser
Species Human (GRCh38)
Location 1:81592633-81592655
Sequence CTTTCGGAGAAGGGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 315}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909939360 Original CRISPR CTTTCGGAGAAGGGGAAGGA AGG Intronic
902191388 1:14765629-14765651 CGAATGGAGAAGGGGAAGGAAGG + Intronic
902706055 1:18205481-18205503 CTTGCTGACAAGGAGAAGGATGG + Intronic
902998904 1:20250345-20250367 TTTTGGGAGAAAGGGAAGAAGGG + Intergenic
904419998 1:30385250-30385272 CTGTAGGAGATGGGAAAGGAGGG - Intergenic
904562893 1:31410684-31410706 ATTTCCGGGAAGGGGATGGACGG + Intronic
904713264 1:32447768-32447790 CCCTAGGGGAAGGGGAAGGAGGG - Intergenic
905847805 1:41247460-41247482 CATTAAGAGAAAGGGAAGGAAGG - Intergenic
906729303 1:48067411-48067433 CTTTTACAGAAGGGGAAGGCAGG - Intergenic
906948616 1:50316593-50316615 CTTTCTGAGGAGGGGCAGAAAGG + Intergenic
907408876 1:54270935-54270957 CCTTCACAGAAGGTGAAGGAGGG + Intronic
909103940 1:71384920-71384942 ATTTGGGAGAAGGTGAGGGAAGG + Intergenic
909939360 1:81592633-81592655 CTTTCGGAGAAGGGGAAGGAAGG + Intronic
909959340 1:81819855-81819877 CTTTCTGAAAAGGGGCAGGCTGG - Intronic
912383838 1:109261646-109261668 CTTTGGAAGATGGGCAAGGATGG - Intronic
914719657 1:150279487-150279509 CTTACAGTGATGGGGAAGGATGG + Intronic
915406344 1:155662755-155662777 CTTTGGGAGAACGAGGAGGATGG + Intronic
915605531 1:156947896-156947918 CTCTAGGAGGTGGGGAAGGAGGG + Exonic
915899144 1:159834022-159834044 CTTCTTGAGAAGAGGAAGGAAGG + Intronic
915940511 1:160115687-160115709 CTTTCGGAGGAGGGGAAGGCGGG + Intergenic
915952033 1:160195874-160195896 CTTTGGGAGAGGGGGTAGGAGGG - Intronic
917315453 1:173720008-173720030 CTTTGGGAGATGGAGGAGGAAGG + Intronic
917435429 1:175016368-175016390 CTTTCGGGGAACAAGAAGGAAGG - Intronic
917854956 1:179092319-179092341 CTTTCAGAGCTGGGTAAGGAGGG + Intronic
918101115 1:181375729-181375751 CTCACGGAGGAGGGGAAGGGGGG - Intergenic
918676370 1:187290855-187290877 TTTTCTGAGAAGGTGAAGTAGGG - Intergenic
919442440 1:197653648-197653670 CTTTCTGAGAAGAGGAAATAGGG - Intronic
919830673 1:201538624-201538646 CTTTAGGAGAAGGGGACAGATGG - Intergenic
920035118 1:203060521-203060543 CTTTGTGAGGATGGGAAGGAAGG - Intronic
920074707 1:203327639-203327661 CTTTCAGAGAAGGGGGAGGCGGG + Intergenic
921217305 1:212949230-212949252 CTTTGGGAGAAAGAGGAGGAAGG - Intergenic
921923928 1:220696186-220696208 CTTTCAGATAAGGTGAAGGAAGG + Intronic
922072531 1:222209915-222209937 TTTTGGGAGAAGGAGATGGAAGG + Intergenic
922329681 1:224563345-224563367 CTGTCAGAGAAGGGGAGAGAAGG + Intronic
922625827 1:227041296-227041318 CTACTAGAGAAGGGGAAGGAGGG - Intronic
923872516 1:238011262-238011284 CTTTCAGAATAGGGGAAGGATGG + Intergenic
924009329 1:239647526-239647548 CTTTGGGAGGTGGGCAAGGAAGG - Intronic
924159042 1:241211039-241211061 CTTTGGGAGGACGAGAAGGATGG + Intronic
924550100 1:245067894-245067916 CTTTGGGAGATGGGGGAGAATGG + Intronic
1065428806 10:25632735-25632757 ATGTCAGAGAAAGGGAAGGAGGG - Intergenic
1065815890 10:29482275-29482297 CTTTGGGAGACTGAGAAGGAAGG - Intronic
1066005993 10:31146616-31146638 CTTTCGGAGTTGGGAAAGGAGGG + Intergenic
1066470395 10:35692185-35692207 ATTTCTGAGAAGCGGATGGAAGG - Intergenic
1067179929 10:43977451-43977473 CTATGGGAGAAGGGTAAGGATGG + Intergenic
1067196684 10:44125960-44125982 CTGGAGGAGATGGGGAAGGAGGG + Intergenic
1067285487 10:44904744-44904766 CTGGAGGAGAAGGAGAAGGATGG + Intergenic
1069961798 10:72083534-72083556 CTTTTTGAGAAGGGGACGGGAGG + Intronic
1070619144 10:77993675-77993697 CTTAGGGAGAAAGAGAAGGAAGG - Intronic
1071575927 10:86726278-86726300 CTTTCTGAGAAGAGGCAGGAGGG + Intronic
1072259171 10:93651405-93651427 CTGAAGGAGAAGGGGAAGCAAGG + Intronic
1072897461 10:99379047-99379069 CTTCCCCAGAAGGGGAAGTAGGG + Intronic
1073196645 10:101696596-101696618 CATTTGGAGAGGGGGAGGGATGG - Intergenic
1073710021 10:106025913-106025935 TTTTCTGATAAGGAGAAGGAAGG - Intergenic
1074044415 10:109824135-109824157 CTTTTAGGGAAGGGGATGGAGGG + Intergenic
1075198260 10:120379645-120379667 CTTTTGGAGAAGAGGAAACATGG + Intergenic
1075879450 10:125837848-125837870 CTGTCGGGGAAGAGGAAGGAGGG - Intronic
1075903017 10:126058142-126058164 CCTTGGGAGGAGGGAAAGGAGGG - Intronic
1077243612 11:1524974-1524996 CTGCTGGGGAAGGGGAAGGAAGG + Intergenic
1078258922 11:9685876-9685898 CTTTGGGAGGAGGCCAAGGAAGG - Intronic
1078334943 11:10455832-10455854 CTTTCTGAGAAGAGGCAGGTCGG + Intronic
1082000454 11:47391219-47391241 TTTTCGGAGCAGGGGACGGCGGG + Intergenic
1082268633 11:50145505-50145527 TTTGGGGGGAAGGGGAAGGAGGG + Intergenic
1083242393 11:61398519-61398541 GGTTCTGAGAAGGGGCAGGATGG - Exonic
1084462558 11:69303996-69304018 ATTAGGGAGCAGGGGAAGGATGG + Intronic
1084915807 11:72428186-72428208 CTTTGGGTGAGGGGGAGGGAAGG + Intronic
1084920914 11:72469036-72469058 ATTTAGGGGAAGGTGAAGGAAGG + Intergenic
1086480031 11:87224721-87224743 CATACGGAGAAGGAGAAGAAAGG - Intronic
1086545424 11:87962163-87962185 CTTTCGGAAAAGGGCAAGACTGG - Intergenic
1086893735 11:92288682-92288704 ATTTAGGAGTAGGGGAGGGAAGG - Intergenic
1087315445 11:96597177-96597199 CTTTAGAATAAGGGGAAGAATGG - Intergenic
1088945705 11:114510519-114510541 CTTTCTAAGAAAGGGAAGAAAGG - Intergenic
1089588108 11:119522753-119522775 CATCTGGAGCAGGGGAAGGAAGG - Intergenic
1089796218 11:120983386-120983408 CTTTCGGTGCAGGGGTAGGGAGG - Intronic
1090188353 11:124752370-124752392 CTTGGGGAGAAGAGGAAGGAAGG - Intergenic
1090383171 11:126340995-126341017 GTTTTGGGGAAGGGAAAGGAAGG - Intronic
1090441539 11:126728937-126728959 CTTTCGGGGCAGAGGGAGGAGGG + Intronic
1091410833 12:238089-238111 TTCTAGGAGAATGGGAAGGAAGG + Intronic
1092505959 12:9100520-9100542 CTTTGGGAGAACGGGATGGGAGG - Intronic
1092970896 12:13693740-13693762 TCACCGGAGAAGGGGAAGGAGGG - Intronic
1093057473 12:14568990-14569012 CAGTGGGAGAGGGGGAAGGAGGG + Intergenic
1093542105 12:20299338-20299360 ATTTGGGTGAAGGGGGAGGAAGG - Intergenic
1093958652 12:25250454-25250476 CTCTCGGGGAGGAGGAAGGAAGG + Intronic
1096995438 12:55835164-55835186 CTTATGGGGAAGGGGGAGGAAGG + Intergenic
1097156278 12:57014520-57014542 CTCAAGGAGAAGGGGTAGGATGG + Intronic
1097866174 12:64560847-64560869 CTGTGAGAGACGGGGAAGGAAGG + Intergenic
1099325735 12:81212502-81212524 CTTTCAAAGAAGGAGAAGAATGG - Intronic
1099736470 12:86572872-86572894 CTTAGGAAAAAGGGGAAGGAAGG - Intronic
1101292937 12:103389582-103389604 CTTTCATTGAAAGGGAAGGATGG - Intronic
1102268121 12:111506648-111506670 CGTGGGGAGAAGGAGAAGGAGGG - Intronic
1103610410 12:122120724-122120746 CTTCAGGAGCAGGGGAAGGAGGG + Intronic
1104312000 12:127661837-127661859 CTCTGGGAGAAGGGAAGGGATGG - Intergenic
1104931620 12:132342196-132342218 GTCACGGAGAAGGGGAAGGCAGG - Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105835122 13:24203319-24203341 ATTTAGGGGAAGGGGAAGAAGGG + Intronic
1106132768 13:26953247-26953269 CTTAAGGAGAAGGGAAGGGAGGG + Intergenic
1106466795 13:30020987-30021009 CTTTGGGAGAAGCTGAAGGACGG + Intergenic
1106556129 13:30810161-30810183 CTTTGGGAGAAGGTGAAGATGGG - Intergenic
1109301270 13:60592632-60592654 CTTGCGGAGAAGGGGCATCACGG + Intergenic
1109567596 13:64137798-64137820 CTTTAGGGGAAAGGGCAGGAAGG + Intergenic
1110375327 13:74786857-74786879 CTGTCTCAGAAAGGGAAGGAAGG + Intergenic
1110663385 13:78085841-78085863 CTTAAGGAAAAGGGGAAGGGAGG - Intergenic
1110706146 13:78603145-78603167 GTTTCGGAGACGGGGAGGGGCGG + Intronic
1111835623 13:93385264-93385286 CCACTGGAGAAGGGGAAGGAGGG + Intronic
1113315009 13:109169812-109169834 CTTTCAGAGAATAGGAAGGAAGG + Intronic
1113615832 13:111680210-111680232 TTTTCAGGGAAGGGGAAGAAAGG - Intergenic
1113621300 13:111765103-111765125 TTTTCAGGGAAGGGGAAGAAAGG - Intergenic
1115127226 14:30010512-30010534 CTTGGGGAGCAGGGGCAGGAGGG + Intronic
1115751907 14:36502562-36502584 CATTCTGGGAAGGGCAAGGAGGG - Intronic
1116503941 14:45654740-45654762 CATATGGGGAAGGGGAAGGAGGG + Intergenic
1117048180 14:51834146-51834168 CTTTTGGAGATGGGGGAAGAAGG + Intronic
1117089527 14:52236134-52236156 CTGAAGGAGATGGGGAAGGAAGG + Intergenic
1119522907 14:75299143-75299165 CCTTCAGTAAAGGGGAAGGAGGG + Intergenic
1120445625 14:84591704-84591726 TTTCCTGAGAAAGGGAAGGAGGG + Intergenic
1121001894 14:90456927-90456949 CTGCCGGGGATGGGGAAGGAGGG + Intergenic
1123710264 15:22981125-22981147 CTTACGGAGAACAGTAAGGATGG + Intergenic
1124630267 15:31332505-31332527 CTTTCAGCGAGGGGGAAGGGGGG - Intronic
1124694741 15:31854576-31854598 CTTTCTTAAAAGTGGAAGGAGGG - Intronic
1125646812 15:41279471-41279493 CTTTGGGAGAAGGGGAATGAGGG - Exonic
1126557630 15:50006719-50006741 CTTTTTGTGAAGGGAAAGGAAGG + Intronic
1126790033 15:52212518-52212540 CACTCGCAGAAGAGGAAGGAAGG + Intronic
1128668070 15:69553116-69553138 CTTCCGCAGAAAGAGAAGGAAGG - Intergenic
1128868826 15:71136804-71136826 CCTGAGGAGAAGGGGCAGGAAGG + Intronic
1130642326 15:85689892-85689914 CTGGCTGAGAAAGGGAAGGAGGG - Intronic
1131063812 15:89420629-89420651 CTTTCTGAGAAGTGGAAGTAGGG + Intergenic
1131670973 15:94619267-94619289 CTTTGGGAGAATGGGGAGAAGGG + Intergenic
1133751557 16:8729967-8729989 GTATCTGAGAAGGGGGAGGAAGG + Intronic
1133873259 16:9709418-9709440 TTCCAGGAGAAGGGGAAGGAAGG - Intergenic
1135423292 16:22318758-22318780 CTCTCGGTGGAGGGGAGGGAAGG + Intronic
1136088513 16:27902459-27902481 CTTCAGGAGGTGGGGAAGGAGGG + Intronic
1137858578 16:51821989-51822011 GGATTGGAGAAGGGGAAGGAGGG + Intergenic
1138291278 16:55849282-55849304 ATTTCTGGGAAGGGGAGGGAGGG + Intronic
1141463852 16:84194444-84194466 CTCACCGAGAAGGGGAAGCAGGG - Exonic
1142742930 17:1941411-1941433 CTCTCAGAGGAGGGGCAGGAGGG - Intronic
1143018308 17:3903613-3903635 CTCTCGGAGAAGGGCAGGGCTGG + Exonic
1143180794 17:4982806-4982828 CTCTGGAAGAAGCGGAAGGATGG - Exonic
1144622180 17:16824610-16824632 CCCTCGGAGCAGGGGGAGGAAGG - Intergenic
1144690438 17:17258966-17258988 CCTAAGGAGAAGAGGAAGGAAGG - Intronic
1145266853 17:21383684-21383706 TTCTCTGAGAAGGGAAAGGAGGG - Intronic
1146656298 17:34637154-34637176 CTGGAGGAGAAGGAGAAGGAGGG - Intronic
1147251968 17:39158091-39158113 CCGTCGAAGAAAGGGAAGGAGGG + Intronic
1147574149 17:41588950-41588972 CCCTCGGAGGAGGGGGAGGAAGG - Intergenic
1147596894 17:41723426-41723448 ATTTCAGAGGATGGGAAGGAGGG + Exonic
1147970268 17:44215649-44215671 CTTCCGGAGAAGAAGAAGGTGGG - Exonic
1148345142 17:46898124-46898146 CTTTGGGTGAATGGGATGGAGGG - Intergenic
1148580084 17:48737697-48737719 CTTTAAGAGAAGGGAAAGGTGGG - Intergenic
1150137243 17:62702840-62702862 CTTTTGGAGAAAGCGCAGGATGG - Intronic
1151272313 17:73006437-73006459 GTCTTGGAGAAGGGAAAGGAAGG + Intronic
1152280378 17:79381786-79381808 CATTTGGAGATGGGAAAGGAAGG - Intronic
1152552058 17:81034942-81034964 GTTCCGGAGAAGGGGGAGGGGGG - Intergenic
1152656693 17:81523207-81523229 CTTTCGGGGAGGGGCAGGGAGGG + Intronic
1152936078 17:83137572-83137594 CTCTCGGAGTGGGGGAAGGAAGG + Intergenic
1153155736 18:2146726-2146748 CTTTGGGAGAATGGGATGGGAGG - Intergenic
1156674614 18:39512768-39512790 CATGAGGAGAAGGAGAAGGATGG - Intergenic
1156700487 18:39819047-39819069 CTTTGAGAGAATGGAAAGGAGGG + Intergenic
1156987094 18:43361398-43361420 CTTAAGGAGAAGGGGTGGGAGGG - Intergenic
1157339409 18:46766051-46766073 ATTTATGAGAAGGGGAATGAGGG - Intergenic
1157392701 18:47316285-47316307 CTTTGGGAGAAGGGGAGGAATGG + Intergenic
1157400431 18:47382444-47382466 CTTTCGGTGAAAGGGAAGGTAGG + Intergenic
1157451510 18:47792620-47792642 CCTGGGGAGAAGGGGAATGATGG - Intergenic
1157622824 18:49026066-49026088 CTTTGGGAGCCCGGGAAGGAAGG + Intergenic
1159296196 18:66492393-66492415 TTTTTGGTGGAGGGGAAGGAAGG + Intergenic
1161039343 19:2101717-2101739 CGTCCGGGGGAGGGGAAGGAAGG - Exonic
1161238213 19:3208312-3208334 CAGTCGGAGAAGGGGAAGGCTGG - Exonic
1161464975 19:4424303-4424325 CTCTGGGTAAAGGGGAAGGAGGG - Intronic
1163223809 19:15940481-15940503 CTTGAGGAGAGGGGGAAGGTTGG + Intergenic
1163784850 19:19269766-19269788 CTTCCTGAGCAGGGGATGGAGGG + Exonic
1164412666 19:28018915-28018937 CTGTCAGAGATGGGCAAGGATGG + Intergenic
1164517152 19:28946272-28946294 CTGTCAGAGATGGGCAAGGATGG + Intergenic
1166826561 19:45613510-45613532 CTTGGGGAGATGGGGATGGACGG - Intronic
1167427447 19:49436778-49436800 CTTCTGGAGAAGCGGCAGGAAGG - Exonic
1167572964 19:50301638-50301660 CTGTAGCAGGAGGGGAAGGAAGG - Intronic
1167633518 19:50639913-50639935 GGTTCGGAGTGGGGGAAGGAGGG - Intronic
1168271849 19:55254449-55254471 CTGTCCAAGCAGGGGAAGGAAGG - Intronic
925955716 2:8961960-8961982 CTGGAGGAGAGGGGGAAGGAAGG - Intronic
925957810 2:8985525-8985547 CTTTTGGAGCATGGGAAGGGTGG - Intronic
926589805 2:14728506-14728528 CTTGCAGAGAATGGGAATGAGGG - Intergenic
927044245 2:19261422-19261444 CTTGCGGCTACGGGGAAGGAGGG + Intergenic
927530036 2:23788473-23788495 CTTTAGGAAAATGGGAGGGATGG - Intronic
927626817 2:24730255-24730277 CTTTCCTAGGAGAGGAAGGATGG - Intronic
928238750 2:29568617-29568639 CTTACAGAGCAGGGGAGGGAAGG - Intronic
928245066 2:29619826-29619848 CCTTCTGACAATGGGAAGGATGG + Intronic
928319757 2:30273786-30273808 ATTTAGGAGAAGAGGTAGGAGGG + Intronic
931620431 2:64204574-64204596 CTTTAGGAAAAAGGGGAGGAGGG + Intergenic
932265053 2:70360756-70360778 ATTTGGGGGAAGGGGAAGCAGGG + Intergenic
932514817 2:72334861-72334883 CTTAAGGAAAAGGGGAAGGGAGG - Intronic
932794065 2:74680041-74680063 CTTCAGGAGAGGGGGAGGGAGGG - Exonic
934125172 2:88881428-88881450 TTTTCTGAGATGGGGAAGGCAGG - Intergenic
934903755 2:98181359-98181381 CCTTTGGAGAAGGGTGAGGAGGG - Intronic
935107230 2:100055926-100055948 CTTTCAGAGTCGGAGAAGGAAGG + Intronic
940014178 2:149086283-149086305 CTTTCTGATCAGGGGAAGAATGG - Intronic
940461865 2:153974669-153974691 GTTCTGGAGAAGAGGAAGGATGG + Intronic
941992286 2:171569101-171569123 CTTTAGGAGAAGGGAGAGAAGGG + Intergenic
942425438 2:175855690-175855712 CTTATGCAGGAGGGGAAGGAAGG - Intergenic
943132869 2:183877416-183877438 CTTGCGGGGAAAGGGTAGGAGGG - Intergenic
945017245 2:205531892-205531914 ATTACAGAGAAGTGGAAGGATGG + Intronic
945881655 2:215330657-215330679 GTTGGGGAGAAGGGAAAGGAGGG - Intronic
946610087 2:221448555-221448577 CTTTAAAAGAAGGGAAAGGACGG - Intronic
947544452 2:231001155-231001177 CTTTTTGGGAAGAGGAAGGAAGG - Intronic
947641984 2:231712034-231712056 GTCTGGCAGAAGGGGAAGGAAGG + Intronic
947705015 2:232267655-232267677 CTTTGGGAGAAGGGGAACTGTGG + Intronic
1169254981 20:4090404-4090426 ATGTCGGAGAAGTGGGAGGAAGG - Intergenic
1169677367 20:8169112-8169134 CATGCGGTGAAGGGGAAGGAAGG + Intronic
1172935355 20:38616187-38616209 CTTGGGGTGAAGGGAAAGGAGGG - Intronic
1174083409 20:47987154-47987176 CATTAGGAGTAGAGGAAGGAAGG - Intergenic
1174515783 20:51091445-51091467 CTTTCGAAAAAGGGGGAGGGTGG - Intergenic
1175287116 20:57844395-57844417 CTGTCCAAGAAAGGGAAGGAAGG + Intergenic
1175474762 20:59263979-59264001 CTTTCCTAGAAGTGGAAAGAAGG + Intergenic
1178076885 21:29020547-29020569 CCTCAAGAGAAGGGGAAGGATGG + Intergenic
1178517056 21:33257018-33257040 TCTTAGGAGAAGGGGAAAGAGGG + Intronic
1178914878 21:36700587-36700609 CTTCTGGAGGAGGTGAAGGAGGG + Intronic
1179005592 21:37511329-37511351 CCTTTGGAGAAGGGCAAGGATGG + Intronic
1180155944 21:45977505-45977527 CTTCCAGAGAAAGGGAAGAAGGG - Intergenic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1183488171 22:38101186-38101208 TTTTAGGAGAAGATGAAGGAAGG - Intronic
1183806956 22:40219740-40219762 CCTTCGGATAAGGTGAGGGAAGG - Intronic
949716842 3:6942164-6942186 CTTACAGAGAAGGGGAAGGTAGG - Intronic
950091634 3:10299848-10299870 TTTTCTGAGTAAGGGAAGGAAGG + Intronic
950107730 3:10398886-10398908 GTCTCGGAGCAGGGGCAGGAGGG - Intronic
950457946 3:13103690-13103712 ATTTCAGAGCAGGGGAAGGTTGG + Intergenic
951439245 3:22704340-22704362 ATTTCTGAAAAGGGGAAGGAAGG + Intergenic
952358874 3:32610205-32610227 CTGGAGGTGAAGGGGAAGGAAGG - Intergenic
952365953 3:32675130-32675152 CTACAGGAGAAAGGGAAGGATGG + Intergenic
953740853 3:45537896-45537918 CTCTCAGAGGAGGGGAAGGAAGG + Intronic
953752380 3:45618591-45618613 CTTTCCTAGAAAGGGAGGGAAGG + Intronic
955493478 3:59506599-59506621 GTCTTGGAGAAGGAGAAGGAGGG + Intergenic
959161225 3:102726605-102726627 CTATCAGAGAAGGAAAAGGATGG - Intergenic
959463532 3:106655839-106655861 ATTTAGGATAAGGGGGAGGAAGG - Intergenic
959495311 3:107043407-107043429 CTGTGGGAGATGGGGAAGGTGGG - Intergenic
960991126 3:123312080-123312102 GTTGTGGAGGAGGGGAAGGATGG - Intronic
961027169 3:123568471-123568493 CTTGAGGATGAGGGGAAGGAAGG - Intronic
961101958 3:124207259-124207281 CTTTCCTGGCAGGGGAAGGAGGG - Intronic
961236755 3:125374638-125374660 CTTTGGGAGAAGGGAAGGGCAGG - Intronic
961607942 3:128111398-128111420 TTTTTGGAGATGGGGAAGAATGG - Intronic
962713561 3:138107913-138107935 GTATCTGAGAAAGGGAAGGATGG - Intronic
964044668 3:152308697-152308719 ATTTCAGAGAGGGGGAAGAATGG - Intronic
964251149 3:154719171-154719193 GTCTAGGAGAAGGGGCAGGAGGG + Intergenic
966947683 3:184788744-184788766 GTTTGTAAGAAGGGGAAGGAAGG + Intergenic
967189936 3:186976259-186976281 CTTACGGAGGAGGGGAAGGTTGG - Intronic
968320834 3:197766684-197766706 CTTTGGGAGACTGAGAAGGATGG - Intronic
970179413 4:13374545-13374567 CTTTCTGAAAAGGGGAATGGTGG - Intronic
970536881 4:17038977-17038999 GTGTGGCAGAAGGGGAAGGAGGG - Intergenic
970539794 4:17065982-17066004 CTATCTGAGCAGGAGAAGGATGG + Intergenic
973648925 4:52978109-52978131 CTTGTGGAGAAGGTGAAGCATGG + Intronic
973650933 4:52996539-52996561 ATTTCTCAGAAGGGGAAGGGAGG - Intronic
973982191 4:56315908-56315930 CTTTCTGCGGAGGGTAAGGAAGG - Exonic
975621945 4:76305343-76305365 CTTCCTGAGATGGGGAAGGTGGG + Intronic
978426067 4:108583892-108583914 CTTTCGGGGAAAGGGTGGGAAGG + Intergenic
978619881 4:110627574-110627596 TGTTTGGAGAAGGGGAAGGAAGG + Intronic
983434036 4:167688768-167688790 GTGGCTGAGAAGGGGAAGGAGGG - Intergenic
983518004 4:168677620-168677642 ATTTAGGAGAAGGGGAGGGGTGG - Intronic
983580648 4:169306397-169306419 CATTTGGAAGAGGGGAAGGAGGG + Intergenic
986240436 5:5955171-5955193 CAAGGGGAGAAGGGGAAGGAGGG - Intergenic
986389840 5:7274474-7274496 CTTCCTGGGAAAGGGAAGGAGGG - Intergenic
988624295 5:32854691-32854713 ATTTAGGAGAAGAGGAAGTAAGG + Intergenic
989336498 5:40323346-40323368 CTGAAGGAGAAGGGGAAGCAAGG + Intergenic
989435322 5:41406202-41406224 CTTTGGGTGAAGGGAAATGAAGG - Intronic
990622029 5:57570406-57570428 CTTTCGGTGTATGGGAAGGGAGG + Intergenic
991360652 5:65816373-65816395 CTTTTGGAGAAGGTGAAAGATGG + Intronic
991367806 5:65887176-65887198 CTTCCTTAGAAGGGGAAGGTTGG + Intergenic
991981042 5:72231002-72231024 CTATCAGAGCAGGGCAAGGATGG - Intronic
991986152 5:72288919-72288941 CTGTAGGAAAAGGGGAAGGTGGG - Intronic
992058745 5:73020589-73020611 CTTTGGGAGAAGGGGAATGATGG + Intronic
992507446 5:77401177-77401199 TTTTCAGAAAGGGGGAAGGAAGG - Intronic
994087845 5:95779810-95779832 GTTTCAGATAAGGGGAAGCATGG + Intronic
996000917 5:118362461-118362483 CTGTCGGTGTAGGGGGAGGAGGG + Intergenic
997663576 5:135608740-135608762 CCTTGGGAGAAGAGGGAGGATGG - Intergenic
997785267 5:136705417-136705439 CTTATGGTGAAGGGGAAGCAAGG + Intergenic
998231170 5:140362226-140362248 TTTACTGAGGAGGGGAAGGAGGG + Intronic
998648556 5:144091484-144091506 CTCTCGGAGAAGGGGGAGCTGGG - Intergenic
999499980 5:152137121-152137143 GTTTTGGAGGAGGGAAAGGAAGG + Intergenic
999688016 5:154119625-154119647 CTTTCGGAGAATGGGGAGGCTGG - Intronic
1000842443 5:166237855-166237877 CTTTGGGATCAGGGTAAGGATGG - Intergenic
1001268141 5:170290121-170290143 CTTTTGGAAAAGGTGGAGGAGGG - Intronic
1001886752 5:175299076-175299098 CTTAAGGAGAAGGGTAAGGATGG + Intergenic
1003128630 6:3376573-3376595 ATTTAGGAGAAGGGAAAGAACGG - Intronic
1005508626 6:26492391-26492413 CTTTCTGAGAGAGAGAAGGAGGG - Intergenic
1006303610 6:33206879-33206901 CCTTCGGGAAAGGGAAAGGAGGG - Intergenic
1006411001 6:33873139-33873161 CTTTGGGAGATGTGGGAGGATGG - Intergenic
1006509514 6:34514576-34514598 CTTGGGGAGAAAGGGAAGAAAGG + Intronic
1006943228 6:37766498-37766520 TTTAGGGAGAAGGGGAGGGATGG + Intergenic
1007478337 6:42133990-42134012 CTGAGGGAGAAGGGGCAGGAGGG - Intronic
1008011216 6:46469662-46469684 CTTTTGGACAAGTAGAAGGATGG - Intronic
1010732117 6:79402298-79402320 CATTGGGAGAAGAGGAAGAAAGG + Intergenic
1011735445 6:90305704-90305726 CATTAGGGGAAGGGGCAGGAAGG + Intergenic
1013324228 6:109028354-109028376 TTTTTGGAGTAGGGGAAGAATGG + Intronic
1013657513 6:112260963-112260985 TGATGGGAGAAGGGGAAGGATGG + Intergenic
1014049510 6:116935747-116935769 CTGTTGGGGAAGGGCAAGGAGGG + Intergenic
1014307896 6:119765391-119765413 CATTTGGATAAGGGGAAGGAGGG + Intergenic
1014947609 6:127516108-127516130 CGCTCGGAGAAGGGGGAGGAGGG - Exonic
1015497525 6:133896317-133896339 CTTTCGGTGAACTGGAAGGAGGG - Intergenic
1015929138 6:138339341-138339363 CTTTCAGAGACTGGGAGGGAGGG - Exonic
1017569633 6:155730969-155730991 CTATAGGAACAGGGGAAGGATGG + Intergenic
1017569641 6:155731010-155731032 CTATAGGAACAGGGGAAGGATGG + Intergenic
1017569664 6:155731133-155731155 CCTTAGGAACAGGGGAAGGATGG + Intergenic
1017569672 6:155731174-155731196 CTATAGGAACAGGGGAAGGATGG + Intergenic
1017569754 6:155731584-155731606 CTATAGGAACAGGGGAAGGATGG + Intergenic
1017569771 6:155731666-155731688 CTATAGGAACAGGGGAAGGATGG + Intergenic
1018061623 6:160094083-160094105 CTTTGGGAGAAGGGGAATGATGG - Intronic
1018681311 6:166268281-166268303 GTTGAGGAGAAGGAGAAGGAGGG + Intergenic
1021745029 7:23731588-23731610 CTTCTGGAAAAGGGGAAGGAAGG - Intronic
1022095126 7:27135491-27135513 AGATCTGAGAAGGGGAAGGAAGG - Intronic
1022243550 7:28535297-28535319 CTTTAGGAAAAGTGAAAGGAGGG + Intronic
1022349886 7:29558060-29558082 CCTATGGAGAAGGGGGAGGAGGG + Intergenic
1023532915 7:41176996-41177018 CTTTTGGAGGAGGAGAAGGAGGG + Intergenic
1024210363 7:47198014-47198036 ATTTGGGAGTTGGGGAAGGAAGG - Intergenic
1024254497 7:47530429-47530451 CTGACGGAGAAGGGCAGGGAAGG + Intronic
1024358955 7:48447635-48447657 TTTTCTGAGGAGGGGAAGAATGG + Intronic
1027402142 7:77820619-77820641 CTTTGGGAGACTGGGGAGGAAGG - Intronic
1028358046 7:89933437-89933459 CTTACGGAGGAGGGTAGGGAAGG + Intergenic
1028581361 7:92412930-92412952 CGTGCGGAGAAGAGGAAGGAGGG - Intergenic
1031822560 7:126522662-126522684 CTTTCAGAGAAGGGAAAGTTGGG - Intronic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1034009533 7:147513933-147513955 CCTTCAGATGAGGGGAAGGAGGG - Intronic
1034309352 7:150072876-150072898 CATTTGGATAAGGGGAAGAAGGG + Intergenic
1034494365 7:151410804-151410826 CCTAGGGAGAAGGGCAAGGAAGG + Intergenic
1034797505 7:154027764-154027786 CATTTGGATAAGGGGAAGAAGGG - Intronic
1035321482 7:158032351-158032373 CTTTCAAAGCCGGGGAAGGAGGG - Intronic
1035765343 8:2100703-2100725 CTTGCAGAGCAGGGTAAGGAGGG - Intronic
1036803366 8:11809095-11809117 CTTTCAGAGAAGAGGGGGGAGGG + Intronic
1036912549 8:12769253-12769275 CTTTTGGAGAAAAAGAAGGAAGG - Intergenic
1037539830 8:19860365-19860387 CATTGGTAGAACGGGAAGGAGGG - Intergenic
1038914803 8:32009239-32009261 CTGTTGGAGTAGGGGAATGATGG - Intronic
1041121392 8:54590035-54590057 CTTTCATAGAAGCAGAAGGAAGG - Intergenic
1041580167 8:59449536-59449558 CTTTTGTATAAGGTGAAGGAAGG - Intergenic
1041776488 8:61528720-61528742 CTGTGGGTGAAGGGGCAGGAAGG - Intronic
1043745218 8:83866869-83866891 TTTTCTGAGTAGGGGATGGATGG + Intergenic
1044514844 8:93126116-93126138 CTATCTGAGTAGGGCAAGGAAGG - Intergenic
1045192056 8:99893118-99893140 CTGCCGCAGGAGGGGAAGGATGG - Intronic
1045361534 8:101437828-101437850 CTTTCGAGGAGGGAGAAGGAGGG + Intergenic
1045385065 8:101664681-101664703 CTTTAGGAGAGAGGGAGGGAGGG + Intronic
1045449712 8:102310254-102310276 CTTTTGGAAATGAGGAAGGAGGG - Intronic
1045501349 8:102746652-102746674 CTCTCAGAAAAGGGTAAGGATGG - Intergenic
1046967494 8:120183866-120183888 ATTTCGGAGAAAGGAAGGGAGGG - Intronic
1047908080 8:129494269-129494291 CTTTGGGAGGCGGAGAAGGAGGG + Intergenic
1048502602 8:134992401-134992423 CTTTCTGAGGAGGGAAAGGCTGG + Intergenic
1048991018 8:139760183-139760205 CTCTGTGAGTAGGGGAAGGAGGG + Intronic
1056837786 9:89971311-89971333 ACTTAGGAGATGGGGAAGGAAGG + Intergenic
1057775190 9:98002099-98002121 CTGTAGGAGAAGGTGAAGGGGGG + Intronic
1057923152 9:99116263-99116285 CCATGGGAGAAGGGAAAGGAGGG + Intronic
1059015086 9:110506734-110506756 GTTTCCAAGCAGGGGAAGGAGGG + Intronic
1059473775 9:114527521-114527543 CTCTAGGAGATGGGGAAGGGAGG - Intergenic
1059769397 9:117412885-117412907 ATGTCCGAGAAAGGGAAGGAGGG - Intronic
1060000359 9:119952981-119953003 CTGTAGGAGAAGGGGAGGAATGG - Intergenic
1060434646 9:123583085-123583107 CTTTGGGGAATGGGGAAGGAGGG - Intronic
1060583697 9:124772527-124772549 CTTTCGTAGCAGGTGAGGGACGG - Intergenic
1060680335 9:125557142-125557164 CTTCTGGAGAATAGGAAGGAGGG - Intronic
1062016075 9:134292027-134292049 CTCCTGGAGAAGGGGCAGGAGGG + Intergenic
1187250779 X:17596270-17596292 CTTCCTTAGAATGGGAAGGATGG + Intronic
1187642515 X:21310580-21310602 TTCTTGGAGAAGGTGAAGGAAGG + Intergenic
1187726085 X:22203439-22203461 CTTTCTGGAAAGGGGAAGGTTGG + Intronic
1191882818 X:65859643-65859665 CTTCAGGAGAAAGGGAGGGAAGG - Intergenic
1194458015 X:94128525-94128547 ATTTTGGAGAGGGGGAAGGAAGG + Intergenic
1196050233 X:111296949-111296971 CTTTAGGAGAAAGGGAGGGAAGG + Exonic
1197758130 X:130010423-130010445 GTCTCGGGGAAGGGGAGGGAGGG - Intronic
1198190193 X:134296424-134296446 CTTAAGGAAGAGGGGAAGGAGGG + Intergenic
1198367088 X:135951695-135951717 CTTTAGGAGAGGGTGATGGAGGG + Intergenic
1198637225 X:138712995-138713017 ATTGCAGAGAAGTGGAAGGAGGG - Intronic