ID: 909940140

View in Genome Browser
Species Human (GRCh38)
Location 1:81602131-81602153
Sequence AAACACATGAAGCAGTTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909940139_909940140 15 Left 909940139 1:81602093-81602115 CCATATATAGATTCTGCTACTTA No data
Right 909940140 1:81602131-81602153 AAACACATGAAGCAGTTAATTGG 0: 1
1: 0
2: 1
3: 20
4: 285
909940138_909940140 22 Left 909940138 1:81602086-81602108 CCTCTCTCCATATATAGATTCTG 0: 1
1: 0
2: 0
3: 23
4: 210
Right 909940140 1:81602131-81602153 AAACACATGAAGCAGTTAATTGG 0: 1
1: 0
2: 1
3: 20
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909940140 Original CRISPR AAACACATGAAGCAGTTAAT TGG Intronic
900073634 1:794091-794113 AAACTCATGAAGCAGTTCTGTGG - Intergenic
901252886 1:7795203-7795225 AAACACATACAGCACTTATTAGG - Intronic
902078194 1:13803761-13803783 TAACACATGACCCAGTTGATAGG - Intronic
903426267 1:23256705-23256727 AAACACATGAACCGGTGCATTGG + Intergenic
904774530 1:32898646-32898668 GAACACACGAATCAGTGAATGGG - Intronic
906418730 1:45644412-45644434 AAACAAATGAATAAGTTAATGGG + Intronic
906693423 1:47808416-47808438 AAAAAAATAAAGCAGTAAATTGG + Intronic
908831073 1:68178965-68178987 CAACACAGGAAGCAGTTTTTAGG - Intronic
909281329 1:73757708-73757730 AAAAACAAGAAGAAATTAATGGG - Intergenic
909940140 1:81602131-81602153 AAACACATGAAGCAGTTAATTGG + Intronic
910355779 1:86352309-86352331 ATACTCATGAAACAGTCAATTGG - Intronic
911138311 1:94467211-94467233 AAAAAGATGAAGGATTTAATGGG - Intronic
914374264 1:147059731-147059753 AAGCACAGGGATCAGTTAATAGG + Intergenic
917103145 1:171465798-171465820 AAACACCTGAAGCTGGTGATCGG - Intergenic
918133786 1:181651979-181652001 ATACACATGAAACAGAGAATAGG + Intronic
918432208 1:184473100-184473122 AAAGCCATGGGGCAGTTAATTGG + Intronic
919088940 1:192955245-192955267 AAACATATCAAGCACTTAAAGGG - Intergenic
922269494 1:224018998-224019020 AAACTCATGAAGCAGTTCTGTGG - Intergenic
923270110 1:232347835-232347857 AAACACATGGTGCAGTTGAAGGG + Intergenic
1063287187 10:4703167-4703189 AAATGCAGGAAGCACTTAATTGG - Intergenic
1066478307 10:35770044-35770066 ATAAACATGAAGAAGTTAAAAGG + Intergenic
1067815753 10:49475432-49475454 AAAGACCTGAAGAAGTTAAGGGG + Intronic
1068275273 10:54787122-54787144 AATCACATAATGCAGTTAATTGG + Intronic
1068359532 10:55958384-55958406 AAACACATGAATGCATTAATAGG - Intergenic
1068861312 10:61850798-61850820 AAACACCTGAAGAAGTAATTAGG + Intergenic
1069402153 10:68060580-68060602 AAACACATAAACCATATAATTGG - Intronic
1069935535 10:71913197-71913219 AAACACCTGAAGCAGCTTCTGGG - Intergenic
1071379321 10:85042355-85042377 AAACACATGAAGAAGTTAGGAGG + Intergenic
1072673788 10:97450872-97450894 GAACACAGGAAGGAGTCAATGGG - Intronic
1072857672 10:98966554-98966576 AAAAACAGGAAACAGTTAAATGG + Intronic
1073044340 10:100627967-100627989 CAACACATCAAGCAATTCATGGG - Intergenic
1073685733 10:105751655-105751677 AAACAAATGATGCAGTCAAAAGG - Intergenic
1073931983 10:108586744-108586766 ACACACATGAAATAGGTAATTGG + Intergenic
1074122793 10:110505642-110505664 AAACACAGGAAGCAGATGGTTGG + Intronic
1075607509 10:123823831-123823853 AAACAGAAGAAACAGCTAATGGG + Intronic
1075965644 10:126609606-126609628 AACCACATGAAGAAGTAAGTTGG + Intronic
1076256268 10:129027317-129027339 CACCACATGAAGTAGTTGATTGG + Intergenic
1078264740 11:9746295-9746317 AGACACATGAAGGAGTTCAGAGG + Intronic
1078279553 11:9886680-9886702 AAACACATGAATCACTTACTGGG - Intronic
1079625097 11:22607637-22607659 AAATAAATGAAGCAGGTATTTGG + Intergenic
1081786160 11:45749198-45749220 AAAGACATGAAGCAGAGAAGAGG - Intergenic
1083064691 11:59912750-59912772 AAAGACATTAACCAGTTAACTGG - Intergenic
1083846163 11:65334686-65334708 ACTCACAGGAAGCAGTTCATAGG - Intronic
1087498689 11:98922693-98922715 TAACACATGAAACACTTAAGCGG + Intergenic
1087542366 11:99536073-99536095 ATACAAATGAATCATTTAATAGG + Intronic
1088993799 11:114978339-114978361 TAACTCTTGAAGCAGTTAAAAGG - Intergenic
1089853533 11:121520402-121520424 AAACACATGGAGCAGATGAGTGG + Intronic
1090176569 11:124655160-124655182 AAAAAAAAGAAGAAGTTAATTGG - Intronic
1091195648 11:133728611-133728633 AAACACATCAAACCCTTAATGGG - Intergenic
1093943660 12:25083386-25083408 AAACACACAAAGCAGTTAGGGGG - Intronic
1098141132 12:67451210-67451232 AAACATATGAAGCGGTTCTTAGG - Intergenic
1098441074 12:70518932-70518954 TAACACATGATGCAATTAAATGG + Exonic
1098757838 12:74388400-74388422 CCACACCTGTAGCAGTTAATAGG + Intergenic
1098926502 12:76356625-76356647 AAACACAGGAAGAAATTAAAAGG - Exonic
1100373066 12:93987142-93987164 AAACTCATGTAACAGCTAATGGG - Intergenic
1101073803 12:101106894-101106916 AAAAAAAAGCAGCAGTTAATGGG + Intronic
1103027366 12:117584354-117584376 AAGCACCTTAAGGAGTTAATGGG - Intronic
1103238047 12:119390497-119390519 AAATAGATGAATCAGTGAATGGG + Intronic
1103632374 12:122272285-122272307 AAAATCATGAAGCAGGTAAAGGG - Exonic
1105012820 12:132766968-132766990 AAAAGCAGGAAGCAGATAATGGG - Intergenic
1105551444 13:21399972-21399994 AAAGACAGGAAGCAGTTTAGTGG + Intronic
1105551450 13:21400014-21400036 AAAGACAGGAAGCAGTTTAGTGG - Intronic
1106118785 13:26840082-26840104 AAACACAGGAAGCAGTGATCCGG - Intergenic
1107565082 13:41594030-41594052 AAAACCATGTAGCAGCTAATGGG - Intronic
1110667891 13:78139093-78139115 AAAAAAATGAAGCTGCTAATAGG - Intergenic
1112492725 13:99881817-99881839 AAACACCTAAAGCAGTTGTTAGG - Intronic
1113259399 13:108545115-108545137 AAAAACATGAATCAGGTAGTAGG - Intergenic
1113292941 13:108925904-108925926 AAACACTGGAAGCCTTTAATGGG - Intronic
1116497492 14:45580078-45580100 AAATAAATGATGGAGTTAATTGG - Intergenic
1116512041 14:45757894-45757916 AAAAACATGAAGCAGGAAGTGGG - Intergenic
1116600359 14:46914247-46914269 CAACAAATGAAGCAAATAATTGG + Intronic
1117860381 14:60085640-60085662 AAAAACATGAATCAGATATTTGG + Intergenic
1119409758 14:74423170-74423192 GAACACAGGAAGCAGCCAATGGG + Intronic
1119883959 14:78124629-78124651 AAACTCAGGAAGCAGTTGCTAGG - Intergenic
1121805976 14:96823147-96823169 AAAAACATAAAGCAGGTAAAGGG - Intronic
1123452675 15:20380695-20380717 ACACACATGCACCAGTTAAGAGG - Intergenic
1124028036 15:25984903-25984925 AATCACTTGAAGCAGTGGATGGG - Intergenic
1126699246 15:51353117-51353139 AGACAGATGAACCAGTTTATTGG - Intronic
1128710422 15:69867296-69867318 AAACAGGGGAAGGAGTTAATGGG + Intergenic
1128932245 15:71715910-71715932 ACACACATGAATTAGATAATAGG + Intronic
1128980081 15:72179577-72179599 ACACAAATGCAGGAGTTAATGGG - Intronic
1129129544 15:73481142-73481164 ACACACATGAAGCTGTTACTAGG - Intronic
1130177423 15:81589377-81589399 AAATACATCAAACTGTTAATAGG + Intergenic
1130182552 15:81645277-81645299 AAATACATGGAGAAGTTAACAGG - Intergenic
1133935390 16:10265055-10265077 AAACAAATATAGCAGCTAATAGG + Intergenic
1135389978 16:22083934-22083956 AAACAAATGAAACAGAAAATAGG - Exonic
1135679145 16:24442009-24442031 ATACACATGAAGCATTTAGCAGG - Intergenic
1135821027 16:25686299-25686321 AAACACTAAAACCAGTTAATTGG + Intergenic
1135856160 16:26012600-26012622 AGACACATGAGACAGTTAAATGG + Intronic
1138262479 16:55635023-55635045 AAATACATGAAGCTGGTGATCGG + Intergenic
1138466876 16:57199542-57199564 AAACATATGAAGCTTTTAAGAGG + Intronic
1138990403 16:62384235-62384257 AAAAAGATGAAGTATTTAATTGG - Intergenic
1139223291 16:65207446-65207468 AAACAAATGAATCAGATAAAAGG + Intergenic
1139258408 16:65566306-65566328 AAACCCAGGAAGCAATGAATAGG + Intergenic
1140843410 16:78863718-78863740 AAACAAATGAATAAATTAATGGG + Intronic
1141197381 16:81870345-81870367 AAAGCCATAAAGCAATTAATTGG + Intronic
1143589419 17:7872831-7872853 AAACACTTGAAGCAGTCAACAGG + Intronic
1144473589 17:15565116-15565138 AAACCCATGAAGAATTTAAAAGG - Intergenic
1146077491 17:29744622-29744644 AAATACATTAAGCCATTAATTGG + Intronic
1146857855 17:36269685-36269707 AAAGAAATGAAGCACTTACTGGG - Intronic
1147076649 17:37994221-37994243 AAAGAAATGAAGCACTTACTGGG - Intronic
1147077154 17:37998838-37998860 AAAGAAATGAAGCACTTACTGGG + Intronic
1147088175 17:38073767-38073789 AAAGAAATGAAGCACTTACTGGG - Intergenic
1147109035 17:38246749-38246771 AAAGAAATGAAGCACTTACTGGG + Intergenic
1147231453 17:39021784-39021806 AAAAAAATGAAACAGTTACTTGG + Intergenic
1148420415 17:47541346-47541368 AAAGAAATGAAGCACTTACTGGG - Intronic
1149102188 17:52920116-52920138 ACTCACATGAAGCACTGAATTGG - Intergenic
1149153688 17:53600324-53600346 AAACACATAGACCAGTGAATAGG - Intergenic
1150316222 17:64171481-64171503 AAGAACATCAAGCAGGTAATGGG + Intronic
1155036900 18:22032205-22032227 ATACAGATGAAGCACTTAACCGG + Intergenic
1156186080 18:34665334-34665356 ATACAAATGTAGCAGTTATTTGG - Intronic
1156513007 18:37657106-37657128 AAACTCATGAAGGAATTAAGAGG - Intergenic
1156616078 18:38785945-38785967 AAACACATGTTGCAGGTAAAGGG - Intergenic
1156697958 18:39790782-39790804 AAACACATGATGATGTGAATTGG + Intergenic
1156827577 18:41450386-41450408 AAACAGATAAAGCAATTAAATGG - Intergenic
1157835677 18:50900082-50900104 AAACACATAAATCAGTACATGGG - Intronic
1158053127 18:53247987-53248009 TCAGACATGGAGCAGTTAATGGG - Intronic
1158093607 18:53744779-53744801 CAAAACATTAAGCATTTAATTGG + Intergenic
1158775918 18:60579213-60579235 AAACACATTAATCAGTGAAATGG - Intergenic
1159314307 18:66751583-66751605 ATACATATGAAGGAGCTAATAGG - Intergenic
1159316307 18:66778193-66778215 ACACACATGGTCCAGTTAATGGG + Intergenic
1159490887 18:69132916-69132938 GAACAGATGAACCAGTTACTTGG + Intergenic
1159983481 18:74813983-74814005 CAACACAGAAAGCAGATAATGGG - Intronic
1164118589 19:22245462-22245484 AGTCAAATGAAGCAGTTGATGGG + Intergenic
1164201675 19:23024308-23024330 AGTCAAATGAAGCAGTTGATGGG + Intergenic
1164752463 19:30666711-30666733 AAACAAATAAAGCAATTAAAAGG - Intronic
1164980627 19:32611062-32611084 ACAGACATGAAGCAGTTTAGTGG + Intronic
926482522 2:13417592-13417614 ACACACATGCACCAGTTAAGAGG + Intergenic
927274171 2:21247663-21247685 GAACACATAAAGCAGTTAGATGG - Intergenic
928892129 2:36216410-36216432 CAAGAAATGAAGCAGATAATAGG - Intergenic
928921360 2:36531667-36531689 AAACAGTTGAAGAAGTTAACCGG + Intronic
929267724 2:39937964-39937986 AAATACATGAAGCAAGTAAAAGG + Intergenic
929324005 2:40583636-40583658 AAAGACATGATGCATTTAATTGG - Intronic
932814090 2:74847971-74847993 AAACCTATGAAGCATTTCATGGG + Intronic
933586567 2:84185841-84185863 AAATACATTAAGCAATTATTCGG - Intergenic
935150359 2:100428661-100428683 AAACAAATGAAGGAGAAAATAGG + Intergenic
936745112 2:115566414-115566436 AAACACATGAATGAATAAATGGG - Intronic
937856569 2:126676114-126676136 AAAGACATGAGGCAGTTACAGGG - Intronic
939011549 2:136852850-136852872 AAACACATGAAGAAATTTAATGG - Intronic
939584522 2:143990371-143990393 AATGACATGAAGAAGGTAATGGG + Intronic
940158594 2:150686485-150686507 GAACACATGAAAAAGTAAATAGG - Intergenic
940607439 2:155944612-155944634 AAACACATTAAGAAATTAAATGG - Intergenic
940783138 2:157954346-157954368 AAACACATGAAGAAACTACTTGG + Intronic
941165259 2:162077048-162077070 AATAATAGGAAGCAGTTAATGGG + Intergenic
941440377 2:165528282-165528304 CAGCAAAGGAAGCAGTTAATAGG - Intronic
942224372 2:173802437-173802459 ATACACATGAAGAAGTGAACAGG + Intergenic
942492498 2:176503856-176503878 AAACAAATAAAACAGTTATTTGG - Intergenic
942904472 2:181164655-181164677 AAAAGCATGAAGAAGTTGATGGG - Intergenic
943163676 2:184287828-184287850 AAACAAACCAAGAAGTTAATGGG - Intergenic
943562462 2:189480180-189480202 AGACACTTAAAGCAGCTAATTGG + Intergenic
945424263 2:209680579-209680601 AAATGCATGAATCAGGTAATGGG + Intronic
945637439 2:212372970-212372992 AAAAACAAAAAGCAGTAAATTGG + Intronic
945850416 2:214999477-214999499 AAACAAATGAAATAATTAATGGG + Intronic
945884559 2:215361592-215361614 AAAGGCATGAAGCACTCAATTGG + Exonic
1170242126 20:14178521-14178543 AAACATATACAGGAGTTAATAGG + Intronic
1170849548 20:19992497-19992519 GCACCCATGAAGCAGTTACTTGG + Intronic
1171403283 20:24892958-24892980 AAACACCTCAAGCAGTCATTTGG + Intergenic
1171489557 20:25507375-25507397 AAACACATCAAGAAGATAAGCGG - Intronic
1172398990 20:34632887-34632909 AAACACATCAAATAGTTTATAGG - Intronic
1172932959 20:38599342-38599364 ATACACATCAAGCACTTAAATGG - Intergenic
1174074385 20:47922372-47922394 AAACTCAGGAAACAGTGAATTGG + Intergenic
1174710870 20:52703687-52703709 AAACGCATGAAGCACTTCGTGGG + Intergenic
1174891099 20:54395307-54395329 AAAAACGTGAAGCAGATAAATGG - Intergenic
1177590946 21:23166607-23166629 AAACAAATGAATAAATTAATAGG - Intergenic
1177828914 21:26114679-26114701 AAAAAAATGAAGCATTTACTTGG - Intronic
1177957771 21:27622096-27622118 AAAGTAAGGAAGCAGTTAATAGG + Intergenic
1177996797 21:28110223-28110245 GAACACATGAAGGAGTACATGGG - Intergenic
1178468174 21:32868056-32868078 AAGCAGATGAAACAGTTAATAGG - Intergenic
1178671156 21:34592704-34592726 AAACACAAGAAACAGATGATTGG - Intronic
1178719378 21:34994900-34994922 CAACTTCTGAAGCAGTTAATTGG + Intronic
1179553739 21:42159721-42159743 AAACAGGTGAGGCAGTTAATCGG + Intergenic
1180153157 21:45962785-45962807 AGACACAGGAGGCAGATAATGGG - Intergenic
1182966766 22:34528869-34528891 AAAGACATGAAGTAGGTAAGTGG + Intergenic
951084848 3:18499754-18499776 AAACAAATGAAGCAGTAATAAGG - Intergenic
951855297 3:27189673-27189695 AAAGACAGTATGCAGTTAATTGG - Intronic
952951629 3:38530223-38530245 AAAGACCTGAGGCAGTTAGTTGG - Intronic
954844425 3:53543146-53543168 AAATAAATGAAGAAGTCAATCGG + Intronic
955098419 3:55823068-55823090 AAAGACATGAAGGAGTCATTTGG + Intronic
955719742 3:61868095-61868117 AAACACATGAAGAAGTGCAGAGG + Intronic
955730472 3:61980326-61980348 AAATCCATGAAGCACTTAACGGG - Intronic
956194483 3:66638375-66638397 AAACATATTTAGAAGTTAATGGG - Intergenic
956449609 3:69360443-69360465 AAAGACATTAATCAGATAATTGG - Intronic
959525436 3:107371581-107371603 ACAGACTTGAAGCAGTTAAGTGG - Intergenic
959716464 3:109438988-109439010 GGACACCTGAAGCATTTAATCGG - Intergenic
960956949 3:123039302-123039324 AAACACATGAACCAGTTGGTTGG + Intergenic
963486824 3:145945039-145945061 AAATACATCAAGCATTAAATGGG + Intergenic
964448681 3:156788013-156788035 AACCACATGGAGCAGATAAATGG - Intergenic
964848205 3:161066443-161066465 AAAGACATGAAGCAGGTAAGGGG + Intronic
966210825 3:177451662-177451684 AAACAACTGAAGCAGTGAATGGG + Intergenic
967998758 3:195186691-195186713 ATAGACATTAAGCAGATAATGGG - Intronic
968179791 3:196584423-196584445 AAACACATGAAGTCGTAAACTGG + Exonic
969541316 4:7791325-7791347 AAACATATGCAGCAGTCAAGGGG + Intronic
970106677 4:12593758-12593780 AAAGTCATGAAACAGCTAATTGG + Intergenic
970227636 4:13876342-13876364 TCTCACATGAAGCGGTTAATAGG + Intergenic
971271091 4:25146656-25146678 AAACACAGAAAGCATTTAAAAGG + Intronic
974400306 4:61395623-61395645 AAAAACATGAAGGTTTTAATAGG + Intronic
974916020 4:68179403-68179425 AAACAAATTCAGCAGTTTATCGG + Intergenic
975222891 4:71833591-71833613 AAACATCTGAAGCTGTTGATCGG - Intergenic
975743598 4:77454099-77454121 AGAGATATCAAGCAGTTAATGGG - Intergenic
976014834 4:80539594-80539616 AAATACAGGAAGCAGGTAGTGGG + Intronic
976290061 4:83408777-83408799 AAACACATGAACAAGATAAGAGG + Intronic
978723992 4:111948440-111948462 AAACAGATGTAGAATTTAATTGG - Intergenic
979820805 4:125167894-125167916 AAAGAAATGAAGCATTTTATTGG + Intergenic
980929841 4:139175402-139175424 AAACACATGAAATAGAAAATTGG - Intronic
980978187 4:139631136-139631158 AAACACTTTAAGCAGTTCTTGGG + Intergenic
981615472 4:146639476-146639498 AAAAACATCAAGCAGATAAAGGG - Intronic
984496807 4:180508289-180508311 AAAGACAGAAAGCAGATAATTGG - Intergenic
986803689 5:11287535-11287557 AAACACATAAAGCAGTTCATGGG + Intronic
986968066 5:13299733-13299755 AAATACATGAAGAACTTAAATGG + Intergenic
987552617 5:19403512-19403534 AAACACCTGAAGCTGGTGATCGG - Intergenic
987904613 5:24059831-24059853 AAGCATATGATGCAGGTAATGGG - Intronic
988858005 5:35247757-35247779 AAACACATTAATGAGTTAAACGG + Intergenic
989090676 5:37727368-37727390 AAGCAAATGAAGCAGTTTGTAGG + Intronic
989559900 5:42838139-42838161 AAATAAATGAATGAGTTAATGGG - Intronic
990779110 5:59338001-59338023 AAACACTTGAAAAAGTTCATAGG + Intronic
990955773 5:61336805-61336827 AATCAAATTTAGCAGTTAATTGG + Intronic
991384623 5:66071480-66071502 AAAGATATTAACCAGTTAATTGG + Intronic
991663195 5:68970637-68970659 ACACACATGGAGCAGTAAGTGGG + Intergenic
994193246 5:96892737-96892759 AGACACATGAAGCACAGAATTGG + Intronic
995862362 5:116654462-116654484 AAAAACATGAAGAAGTTCATGGG - Intergenic
997550811 5:134751298-134751320 AAACACAAGAAGCAGTCTCTAGG - Exonic
997585635 5:135041332-135041354 TTACACATAAAGCAGTCAATGGG - Intronic
999023621 5:148199457-148199479 TAACACATGAAACAGATAACAGG - Intergenic
999863847 5:155679141-155679163 CAACATCTGAAGCAGTTAACAGG - Intergenic
1000117017 5:158162768-158162790 AAACACACACACCAGTTAATTGG - Intergenic
1000560091 5:162776619-162776641 AAACAAATGACTCAGTTCATGGG - Intergenic
1004017332 6:11744065-11744087 AAACACACCAAGCTGTTCATAGG - Intronic
1004060280 6:12189470-12189492 AAAAACATGAAATAGTTCATAGG + Intergenic
1007772420 6:44202280-44202302 ATACACAGGCATCAGTTAATCGG - Intergenic
1009657943 6:66569838-66569860 AAACACCTGAAACTGTTGATTGG + Intergenic
1010125945 6:72431948-72431970 AAACACTTGCAGAAGTAAATAGG + Intergenic
1011162417 6:84406383-84406405 GAATACATTAAGCAGTTAAGGGG + Intergenic
1011257822 6:85442009-85442031 AAACACCTTAAGCAATTATTGGG + Intergenic
1012115841 6:95297714-95297736 AAACACCTGAACAAGTTAAAAGG + Intergenic
1012157648 6:95840151-95840173 AAGCACAGGGAGCAGTTAGTGGG - Intergenic
1012182633 6:96174087-96174109 AAACCCATGAAGGAATTACTGGG - Intronic
1012309942 6:97710674-97710696 AAACACATGAATTAATCAATGGG + Intergenic
1012319258 6:97822691-97822713 AAATTCATGTAGCAGCTAATAGG + Intergenic
1012321429 6:97851991-97852013 AAACACATGAAGGATTAATTTGG - Intergenic
1012908955 6:105098131-105098153 AAACACAGGAAGCATCTTATTGG + Exonic
1013160431 6:107538640-107538662 ATACACATGAGGCAGTGAATAGG - Intronic
1013429731 6:110044622-110044644 AAATACAGGAAACATTTAATTGG + Intergenic
1014386382 6:120807055-120807077 AAACACATGGAAAAGTTAATAGG + Intergenic
1015209086 6:130676182-130676204 AAACACCTGTTGCAGTTATTAGG - Intergenic
1016011445 6:139141490-139141512 TAACACATGAAGTAATTAAGTGG - Intronic
1018660075 6:166077510-166077532 GAAGACATTAAGCAGTTAATAGG + Intergenic
1020506998 7:9003429-9003451 AAATAAATAAAACAGTTAATAGG + Intergenic
1020857222 7:13444348-13444370 AAACACATAACGCAGATAAGAGG - Intergenic
1021525956 7:21588187-21588209 GAACACATGAAACAGGTAAGTGG + Exonic
1021854095 7:24836805-24836827 AAACAAATTCAGAAGTTAATTGG - Intronic
1022688438 7:32619484-32619506 AAACACATGGACCATTAAATGGG - Intergenic
1025816191 7:64914449-64914471 AATCACATGAGGCACTTATTAGG - Intronic
1026078583 7:67196836-67196858 AAACACTTGAAGAACTGAATTGG - Intronic
1026148125 7:67765871-67765893 TCTCCCATGAAGCAGTTAATTGG + Intergenic
1026698239 7:72615146-72615168 AAACACTTGAAGAACTGAATTGG + Intronic
1027654129 7:80907643-80907665 ATACTAATGATGCAGTTAATAGG - Intronic
1028071997 7:86461536-86461558 AAAAACCTGAAACAGTCAATTGG - Intergenic
1028074969 7:86501612-86501634 AAACAAATGAAACAGTCAATAGG + Intergenic
1028225264 7:88243730-88243752 AAACACAATAGGCAGTTAGTGGG + Intergenic
1028934467 7:96449676-96449698 AAACAGATAAAGCAGTTAGCAGG - Intergenic
1030021207 7:105276981-105277003 AGAGAGAAGAAGCAGTTAATTGG - Intronic
1030230484 7:107203670-107203692 AATCACATAAAACAGTTAAGGGG + Intronic
1030532802 7:110731001-110731023 AAACACATGTTGCAGCTGATGGG + Intronic
1033867674 7:145712991-145713013 AAACACATGAAGCTGGGGATGGG + Intergenic
1034623696 7:152476160-152476182 AAACACATTTAGGAGTTAAAAGG + Intergenic
1035036285 7:155897378-155897400 AAACACAAGAGGAAGTTTATTGG + Intergenic
1035975811 8:4310129-4310151 AGAAACGTGAAGCAGTTACTAGG - Intronic
1035994959 8:4535059-4535081 AAACACATAAAGAAATAAATTGG - Intronic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1037560559 8:20070627-20070649 AAACACATAAACCAGTAACTTGG + Intergenic
1038161067 8:25038508-25038530 AAACACATAAACAATTTAATAGG - Intergenic
1038446359 8:27606856-27606878 AAACACCAGAAGCAGAGAATAGG - Intronic
1041298455 8:56386687-56386709 AAACACATCAAGAAGTAAAAAGG - Intergenic
1043347126 8:79311349-79311371 AAATTCATGTACCAGTTAATAGG + Intergenic
1043539324 8:81241823-81241845 AAGGACAAGAAACAGTTAATTGG - Intergenic
1044236246 8:89833864-89833886 CAACACATTAAGGAATTAATGGG + Intergenic
1044385920 8:91588159-91588181 AAGCTCATGAGGCAGTTAGTAGG + Intergenic
1045607811 8:103797471-103797493 AAAGATATGAAGAAGATAATGGG - Intronic
1046998309 8:120548366-120548388 AAATATATTAGGCAGTTAATAGG - Intronic
1047319521 8:123766596-123766618 AGACACATGAAGGAGGAAATGGG - Intergenic
1047788751 8:128180809-128180831 AAATACATGAAGAAGTTATTCGG + Intergenic
1048688885 8:136936069-136936091 CAAGACATGAAGGAGTTAACCGG + Intergenic
1050019105 9:1265621-1265643 AAACAAATAAATCAGTTAGTTGG + Intergenic
1051182631 9:14427457-14427479 AAAGTCATCAAGCAGGTAATTGG + Intergenic
1052339904 9:27354677-27354699 AAACATATTAAGCATTTATTAGG + Intronic
1053786495 9:41656198-41656220 ATACACATGAAGAGGCTAATGGG + Intergenic
1055064750 9:72107776-72107798 TAAAACATGAAGAAGTTACTGGG - Intergenic
1055179609 9:73368241-73368263 AAACACAAGAACCAACTAATAGG + Intergenic
1055393240 9:75846090-75846112 AAACACATCAAGCTGTTACGAGG + Intergenic
1055920288 9:81452938-81452960 AAACACAATAAGGAATTAATTGG - Intergenic
1055971933 9:81920198-81920220 AAGGATATGAAGCAGTGAATGGG - Intergenic
1055973686 9:81935270-81935292 AAGGATATGAAGCAGTGAATGGG - Intergenic
1055980501 9:81995522-81995544 AAGGATATGAAGCAGTGAATGGG - Intergenic
1186281351 X:7996185-7996207 AAACAAATGAATCAATAAATCGG + Intergenic
1186502479 X:10062904-10062926 AAATACAGGAAGCATTTAGTAGG + Intronic
1187081051 X:15988074-15988096 AAACCCAAGAAGCAGTTTTTTGG - Intergenic
1187416594 X:19098639-19098661 AAACACATAAAGCAGAGAAGTGG + Intronic
1189561175 X:42192784-42192806 AGACATATGAAGCAGTTAACAGG + Intergenic
1193464323 X:81828986-81829008 AAACACTTGAAGCACATGATAGG + Intergenic
1193950458 X:87790969-87790991 AAATACATGGAGCAATTAACCGG - Intergenic
1194877944 X:99212787-99212809 AAGCACATGAAGCTTTTGATTGG - Intergenic
1195078070 X:101346191-101346213 AATTATAGGAAGCAGTTAATGGG + Exonic
1196201785 X:112894667-112894689 CAACACATAAACCATTTAATAGG + Intergenic
1198434813 X:136606706-136606728 AAACACAAGAAGCTATTGATAGG + Intergenic
1199700637 X:150373102-150373124 AATCACAAGATGAAGTTAATGGG + Intronic
1201461260 Y:14227444-14227466 AAACACATGAAGATCTTAATAGG - Intergenic
1201896974 Y:19002009-19002031 AAACACTTGGAGCATCTAATTGG - Intergenic