ID: 909944435

View in Genome Browser
Species Human (GRCh38)
Location 1:81648005-81648027
Sequence CTAGTGACCCACATCTAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909944435_909944438 8 Left 909944435 1:81648005-81648027 CCTATTTAGATGTGGGTCACTAG 0: 1
1: 0
2: 1
3: 4
4: 71
Right 909944438 1:81648036-81648058 ATGCAAAGAAAACCAAATGTGGG 0: 1
1: 1
2: 8
3: 64
4: 588
909944435_909944437 7 Left 909944435 1:81648005-81648027 CCTATTTAGATGTGGGTCACTAG 0: 1
1: 0
2: 1
3: 4
4: 71
Right 909944437 1:81648035-81648057 AATGCAAAGAAAACCAAATGTGG 0: 1
1: 0
2: 6
3: 77
4: 811
909944435_909944439 18 Left 909944435 1:81648005-81648027 CCTATTTAGATGTGGGTCACTAG 0: 1
1: 0
2: 1
3: 4
4: 71
Right 909944439 1:81648046-81648068 AACCAAATGTGGGAGATGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909944435 Original CRISPR CTAGTGACCCACATCTAAAT AGG (reversed) Intronic
909944435 1:81648005-81648027 CTAGTGACCCACATCTAAATAGG - Intronic
913105146 1:115607467-115607489 CTCTTAACCCACATCTATATTGG + Intergenic
922351869 1:224740862-224740884 CTAGTGACCCTCATCCAGAGAGG + Intergenic
924604655 1:245522308-245522330 CAGCTGGCCCACATCTAAATTGG - Intronic
1071251526 10:83824288-83824310 CTAGTCACCAACAGATAAATAGG - Intergenic
1081458555 11:43249591-43249613 CTATTTCCCCACATCCAAATGGG - Intergenic
1083438906 11:62663110-62663132 CTAGTGAACCACAGCTCAAAAGG - Exonic
1097354332 12:58584733-58584755 GTACTGACCCAGAGCTAAATTGG + Intronic
1099436438 12:82651622-82651644 CGAGTGACTCACATCGAATTAGG - Intergenic
1100601952 12:96119499-96119521 CTATTGACCCATTTTTAAATCGG - Intergenic
1107218341 13:37948999-37949021 AGAGAGACCCACATCTAAAATGG - Intergenic
1113420653 13:110169430-110169452 CCAGTAACCCACATCTTTATTGG - Intronic
1118561786 14:67092927-67092949 ATAGTCACCTACATCTATATAGG - Intronic
1129651586 15:77494839-77494861 CTGGTGACCCACAACTAAATGGG + Intergenic
1133912297 16:10077211-10077233 CTGGTCACCCACATCTCACTGGG - Intronic
1135214344 16:20551824-20551846 CTGGTGAACCACATGTAAAAGGG - Intronic
1146030346 17:29360725-29360747 CTAGGGACCCACATCTGATGAGG - Intergenic
1146781004 17:35672345-35672367 CCAGTGACACAAACCTAAATTGG - Intronic
1147532628 17:41293959-41293981 ACAGTGACCCACAAATAAATGGG - Intergenic
1149387016 17:56152546-56152568 CTATTGACCCACAGATGAATGGG - Intronic
1154169928 18:12044044-12044066 TTGGTGACCCACAGCAAAATGGG - Intergenic
1156977398 18:43239044-43239066 CTAATGACTGACATGTAAATTGG + Intergenic
1158608439 18:58916999-58917021 CTAGGAACACGCATCTAAATTGG + Intronic
1163756282 19:19108171-19108193 CTGTAGACCCACATCCAAATCGG + Intronic
1167223013 19:48215534-48215556 TGAGTGACCCACAACTTAATGGG - Intronic
925042394 2:741945-741967 CTATTGACTCACAATTAAATAGG - Intergenic
931494725 2:62790970-62790992 CCAGAAACCCACATCTATATTGG - Intronic
943811258 2:192192971-192192993 CTATTGACCCAAATCTAATAGGG + Intronic
1168954574 20:1826071-1826093 CTAGTAACCCACATAGAAACTGG - Intergenic
1175012672 20:55755354-55755376 CTAGTAACCCACATATTCATTGG + Intergenic
1176692765 21:9936716-9936738 CTATTGACCTACTTATAAATGGG + Intergenic
1177409932 21:20717083-20717105 CTAGTGAATCACAACTAAACTGG - Intergenic
1180791572 22:18577984-18578006 CCCCTGACCCACATCTGAATGGG + Intergenic
1181230168 22:21417327-21417349 CCCCTGACCCACATCTGAATGGG - Intergenic
1181248481 22:21517536-21517558 CCCCTGACCCACATCTGAATGGG + Intergenic
1181547906 22:23613960-23613982 CTAGTGGACCACATATAAGTTGG + Intronic
950300304 3:11871312-11871334 TTAGTGACCCACATCTGCAGTGG + Intergenic
951501207 3:23389642-23389664 CTAGTGAACCACAGCTCAAAGGG - Intronic
960629493 3:119715292-119715314 CCAGTGACACACATATAAATAGG + Intronic
971711606 4:30120068-30120090 GTAGGGACCCAAACCTAAATAGG + Intergenic
978337293 4:107683330-107683352 CTTGTGACCCACTGCTAAATGGG - Intronic
978854804 4:113382235-113382257 CTACTGACCCACCTTTAACTGGG - Exonic
979943852 4:126799877-126799899 ATATTAACCCACTTCTAAATTGG + Intergenic
980365358 4:131796926-131796948 CTATTGACCTACTTATAAATGGG + Intergenic
981156137 4:141438542-141438564 CTTGAGACCAACACCTAAATGGG - Intergenic
981408769 4:144403165-144403187 CTCCTTACCCACATCTAATTTGG + Intergenic
982142403 4:152338868-152338890 CTATTCACCCACTTCTAAAGTGG - Intronic
983016565 4:162620833-162620855 CAAGAGACCCACATAAAAATAGG - Intergenic
989517541 5:42360980-42361002 AGAGTGACCCAAATTTAAATAGG - Intergenic
989747180 5:44843674-44843696 CAAGTGGCCCATTTCTAAATTGG + Intergenic
992545248 5:77807936-77807958 CTAATGACCCACCTCAAACTAGG - Intronic
992949212 5:81840298-81840320 TTAGTTACCCACATTTAAATTGG + Intergenic
994818329 5:104613800-104613822 TTAGTGACCCACTGCTAAACAGG + Intergenic
995225026 5:109691074-109691096 CTAGAGATTCACATCTAAAAGGG - Intronic
1004461740 6:15842963-15842985 CTATTCACCCACATGTAACTTGG + Intergenic
1006639231 6:35480476-35480498 CTAGGGAACTACATGTAAATGGG + Intronic
1006878901 6:37322044-37322066 AAAATGACCCACATCAAAATGGG - Intronic
1010480891 6:76352349-76352371 CTAGTCACCCTCATCAAATTTGG - Intergenic
1017859567 6:158383026-158383048 CTTATGACCCACGGCTAAATTGG - Intronic
1020736931 7:11962305-11962327 ATAGTGACACAAATCTAACTTGG - Intergenic
1034697707 7:153068854-153068876 AGAGTGACCCACATGTATATAGG + Intergenic
1034783476 7:153903521-153903543 ACAGTGACACACATCTAAGTGGG - Intronic
1035323517 7:158050031-158050053 CTAGTGACCCCCATTTTATTAGG + Intronic
1038123584 8:24645565-24645587 TTAGTGACCCACTCCTAAATAGG + Intergenic
1041134775 8:54746221-54746243 CTAGTGTCCCAGATTAAAATGGG + Intergenic
1051690313 9:19705587-19705609 CTAGTGAGCCACAGCTCAAAAGG + Intronic
1053629714 9:39922781-39922803 CTATTGACCTACTTATAAATGGG + Intergenic
1053776051 9:41540766-41540788 CTATTGACCTACTTATAAATGGG - Intergenic
1054214173 9:62327921-62327943 CTATTGACCTACTTATAAATGGG - Intergenic
1054673311 9:67827438-67827460 CTATTGACCTACTTATAAATGGG + Intergenic
1056469489 9:86891851-86891873 TTAGTGAAGCACATCTAATTAGG - Intergenic
1062045961 9:134424668-134424690 CCAGTGTTCCACATCTGAATTGG - Intronic
1203573255 Un_KI270744v1:152305-152327 CTGGTGACACCCATGTAAATAGG + Intergenic
1187425601 X:19175015-19175037 CTAATTACCAACATCTAAGTTGG - Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1196006160 X:110839425-110839447 CCAGTGACCCAGAGCTGAATTGG + Intergenic
1196710074 X:118753482-118753504 CTAGTGACCCACCACTATCTTGG - Intronic