ID: 909946143

View in Genome Browser
Species Human (GRCh38)
Location 1:81665557-81665579
Sequence TCCCAGATATAGAGCCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909946143_909946147 14 Left 909946143 1:81665557-81665579 CCTCCATGGCTCTATATCTGGGA No data
Right 909946147 1:81665594-81665616 TTCCTGTTGAGAAGCATGTTAGG 0: 1
1: 0
2: 1
3: 17
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909946143 Original CRISPR TCCCAGATATAGAGCCATGG AGG (reversed) Intronic
No off target data available for this crispr