ID: 909948511

View in Genome Browser
Species Human (GRCh38)
Location 1:81690994-81691016
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909948511_909948512 2 Left 909948511 1:81690994-81691016 CCAATCAGCAGCAGGGGAAAATT No data
Right 909948512 1:81691019-81691041 TGAGATTCGTATGAGATTTTTGG 0: 1
1: 0
2: 1
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909948511 Original CRISPR AATTTTCCCCTGCTGCTGAT TGG (reversed) Intronic
No off target data available for this crispr