ID: 909949079

View in Genome Browser
Species Human (GRCh38)
Location 1:81697834-81697856
Sequence CAGGAAATGCACTCTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 284}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909949079_909949085 22 Left 909949079 1:81697834-81697856 CCCTCCTCAGAGTGCATTTCCTG 0: 1
1: 0
2: 3
3: 28
4: 284
Right 909949085 1:81697879-81697901 TAGAAATAGAGTGCAGAACAAGG No data
909949079_909949086 26 Left 909949079 1:81697834-81697856 CCCTCCTCAGAGTGCATTTCCTG 0: 1
1: 0
2: 3
3: 28
4: 284
Right 909949086 1:81697883-81697905 AATAGAGTGCAGAACAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909949079 Original CRISPR CAGGAAATGCACTCTGAGGA GGG (reversed) Intronic
900697084 1:4019212-4019234 GAGGAACCGCACTGTGAGGAGGG - Intergenic
902391626 1:16110491-16110513 CAGGAAAACCGCTCTGAGGAGGG + Intergenic
902855967 1:19205297-19205319 GAAGAAATGGAATCTGAGGAGGG + Intronic
903561748 1:24233284-24233306 TAGGAAAAGCACTCAGCGGAGGG + Intergenic
903589247 1:24441712-24441734 CAGGCAATGCAGTCTCAGGGTGG - Intronic
904083767 1:27888953-27888975 AAATAAATGCACTCTGAGGCTGG - Intergenic
905013446 1:34761975-34761997 CAGGGAGGGCACCCTGAGGATGG + Exonic
905017705 1:34788899-34788921 TGGGAAGTGGACTCTGAGGAAGG + Intronic
905879424 1:41454026-41454048 GAGGAACTGAACTCAGAGGAGGG - Intergenic
906287364 1:44596104-44596126 CTGGAAATGGACTTTTAGGAAGG + Intronic
906726662 1:48049168-48049190 GAGGAAAAGCTGTCTGAGGAGGG + Intergenic
906860837 1:49357423-49357445 CAGGAGATCCACTGTAAGGATGG + Intronic
907720118 1:56964230-56964252 TAGGAAGTTCACTCTGAGGTAGG - Intronic
908248575 1:62247266-62247288 CCGGCAAGGCACTCTGAGGAGGG + Intronic
908326956 1:63032328-63032350 CAGGAATTGCCCTCAGTGGAAGG + Intergenic
909949079 1:81697834-81697856 CAGGAAATGCACTCTGAGGAGGG - Intronic
911631880 1:100192730-100192752 CAGGAAAGGAAGTCTGAGGATGG - Exonic
915064875 1:153216632-153216654 CAGGAAAGGCTCTCAGAGGGTGG + Intergenic
915723972 1:158004599-158004621 CTGGAAAAGCACTCTCAGGACGG + Intronic
916000994 1:160615600-160615622 AAGGAAATGCACCCTGTGGTGGG + Intronic
916117586 1:161500482-161500504 TAGGAAATGCTCCCTGAGGCAGG - Intergenic
916169287 1:161988567-161988589 AAGGAAATGCCTTCTGAGGTGGG - Intronic
916679465 1:167090668-167090690 AGGGAAATGCACTCAGAGGTAGG + Intergenic
918380209 1:183946163-183946185 CAGAAAATGAACTCTGAGTCAGG - Intronic
919672823 1:200353326-200353348 CAGGAAATGGCCTATGTGGAAGG - Intergenic
919972088 1:202587611-202587633 CAGGAAAGGCACACTGATGGTGG + Exonic
919986601 1:202680085-202680107 CAGGATATGCACTCTCTGAAAGG + Intronic
922512269 1:226178933-226178955 CAGGAAATAAACCCTGTGGATGG - Intronic
922612297 1:226939741-226939763 CACAAAAAGCACTCCGAGGAGGG - Intronic
923093356 1:230755798-230755820 GAGGAAATGGAGGCTGAGGAAGG + Intronic
923216418 1:231852034-231852056 CAGGAACAGCACTGTGAGGGAGG + Intronic
923373111 1:233332348-233332370 CAGGGAAGGCACTCCGAGGAAGG + Intronic
923458258 1:234185170-234185192 CAGGAAAGGCATTCTGGGGTGGG + Intronic
1063051813 10:2457744-2457766 GAGGAGAGGCACCCTGAGGAGGG + Intergenic
1063312699 10:4969532-4969554 GATGAAATCCACACTGAGGAAGG + Intronic
1063315240 10:4998015-4998037 GATGAAATCCACACTGAGGAAGG - Intronic
1063639367 10:7815343-7815365 CAGGCAATACCTTCTGAGGATGG + Intergenic
1064349385 10:14562080-14562102 TAGAAAATGCACTCTAAGGCCGG - Intronic
1064740825 10:18432411-18432433 CACAAATTGCACTCTGTGGAGGG + Intronic
1064970966 10:21066723-21066745 CAGTAAATGAACTCTTAAGAAGG - Intronic
1065207616 10:23372287-23372309 CATAATATGCACCCTGAGGATGG - Intergenic
1066387203 10:34951373-34951395 TAGGAACTGCATTCTCAGGAGGG + Intergenic
1067156584 10:43786080-43786102 CAGGAGCCTCACTCTGAGGACGG + Intergenic
1070776774 10:79114354-79114376 TTGGAAATGTGCTCTGAGGATGG + Intronic
1072756151 10:98022475-98022497 CAGAAAAGGCTCTCTGAAGATGG + Intronic
1074115178 10:110451764-110451786 CAGGGCATGCACTGTGAGGCTGG + Intergenic
1074356581 10:112790967-112790989 CACCAAATGCCCTTTGAGGAGGG - Intronic
1074982353 10:118629994-118630016 CAGAATATGCTCTCAGAGGAAGG + Intergenic
1075687631 10:124375483-124375505 GAGGAATTGCACTCTCAGGGGGG + Intergenic
1075714381 10:124547687-124547709 CAGGAGAAGCAGTCTGAGGGAGG + Intronic
1075795226 10:125115390-125115412 CAGGTAATGGACTCTGGGAAGGG + Intronic
1076451739 10:130561206-130561228 GAGGACACGCACTCTGAGAATGG - Intergenic
1076451869 10:130561713-130561735 GAGGACATGCACCCTGAGAATGG - Intergenic
1076607746 10:131700499-131700521 AAGGAAAGGGTCTCTGAGGATGG + Intergenic
1078129866 11:8604625-8604647 TAGGAAAAGCTCTCTGAGGAGGG + Intergenic
1078186296 11:9054578-9054600 GAGGAAATGTACCCTGAGTATGG - Intronic
1080969633 11:37256549-37256571 CAGGCAATGCAGTCTCAGAAAGG + Intergenic
1081657522 11:44867334-44867356 CAGGTGATGCACGCTGGGGAAGG + Intronic
1083791298 11:64988085-64988107 CAGGACAAGCACTCTGAGGCGGG - Exonic
1083823704 11:65186645-65186667 CAGGAGATGAAATCTGAGGCTGG - Intronic
1086503476 11:87478009-87478031 CAGGGCATGCACTGTGAGGTTGG - Intergenic
1088166394 11:106943559-106943581 CAAGAAATGCCATCTGAGGTGGG - Intronic
1088311693 11:108467236-108467258 GAGGAAAGGAGCTCTGAGGAAGG + Intronic
1088800671 11:113303980-113304002 AAGGATATGCAATTTGAGGAAGG + Intergenic
1089215002 11:116829938-116829960 CAGGTAATGCCCTCTGGGGAGGG + Exonic
1089278320 11:117354929-117354951 TAGGAAACGCAGCCTGAGGAGGG + Intronic
1090585111 11:128202766-128202788 CAGTAAGTGCACCCTGGGGAAGG + Intergenic
1091020150 11:132092314-132092336 GAGGCCAGGCACTCTGAGGAAGG - Intronic
1092950433 12:13498555-13498577 CAGGAAAGACACTCTGAGGGAGG - Intergenic
1094853494 12:34392751-34392773 CTGGACATGCACGCTGGGGAGGG - Intergenic
1096434097 12:51573576-51573598 CAGGAGCTTCACTCTGAGGCAGG + Intergenic
1096654777 12:53081970-53081992 CAGTAAATCCTCTTTGAGGAGGG + Intergenic
1097968523 12:65607520-65607542 GTGGAAATGCAGTCTGATGAGGG - Intergenic
1099141014 12:78975300-78975322 CAGAACTTGCAATCTGAGGAGGG - Intronic
1099413896 12:82363283-82363305 TAGGAAATACACTCTGTTGAAGG - Intronic
1100837215 12:98577854-98577876 TAAGAAATGCACTCTGAGGCCGG + Intergenic
1101004544 12:100389063-100389085 CAGGAAGTTTCCTCTGAGGAAGG + Intronic
1101220628 12:102635503-102635525 CAGGAAATGTTCACAGAGGAAGG - Intergenic
1101632166 12:106505682-106505704 GAGAAAAGGCACTCTGGGGAGGG - Intronic
1102324466 12:111967955-111967977 CAGGAAATGGAAACTGAGGGAGG + Intronic
1102717341 12:114985895-114985917 CAGGAAGTGTATTCTGAGTAAGG + Intergenic
1103270326 12:119668176-119668198 CAGGAAAGGGACCCTGAGCAAGG - Exonic
1103707042 12:122881248-122881270 CAGGAAACACAATCTTAGGAAGG + Intronic
1104216644 12:126740408-126740430 AAGCAAATGGACTCTGTGGATGG + Intergenic
1105492690 13:20903251-20903273 AAGGAGGTGCGCTCTGAGGAGGG - Intergenic
1105999179 13:25703438-25703460 CAGAAATTGCACTCTTAGGTAGG + Intronic
1107581023 13:41786008-41786030 AGGGAAATGCACTCAGAGAATGG + Intronic
1107938948 13:45367538-45367560 GAGGGAGTCCACTCTGAGGATGG - Intergenic
1113782749 13:112986057-112986079 AAGGAAATGCCTTCTGAGGCAGG - Intronic
1113794982 13:113051538-113051560 CAGGAAATACACAGTGAAGAAGG - Intronic
1114155454 14:20098913-20098935 TAGGCAATACACACTGAGGAAGG - Intergenic
1114398341 14:22387167-22387189 CAGAAAAGGCACCCAGAGGAAGG - Intergenic
1114817452 14:25977323-25977345 AGGAAAATGCACTCTGAGGGTGG + Intergenic
1115159545 14:30378070-30378092 CAGGAAATGGATTCTGGGGAGGG - Intergenic
1118943269 14:70358825-70358847 CATGAAATGCAGGCTGAGGCTGG - Intronic
1120340192 14:83209490-83209512 CAGGAAATTTACTCTAAAGATGG - Intergenic
1121459283 14:94061606-94061628 CAGGGAATTCACTCTGGGAAGGG - Intronic
1121599209 14:95190673-95190695 CAAGACATGCATTCTGAGGGAGG + Exonic
1122867685 14:104615001-104615023 CAGCAAATGCAGTTTGAGTAGGG - Intergenic
1123990873 15:25682424-25682446 CAGGAAACACACACTGGGGAAGG + Intronic
1125918671 15:43511317-43511339 CAGGAAGTGCACACTAGGGATGG - Intronic
1126499545 15:49330097-49330119 CAGTAAATGGACTTTGAGCATGG + Intronic
1126857023 15:52848469-52848491 CAGGAAAACCACTATGAGGAAGG - Intergenic
1128317601 15:66671073-66671095 CAGGAAAAGGACTCAGGGGAGGG - Intronic
1128396081 15:67227619-67227641 CAAGAAAAGCAGGCTGAGGAAGG + Intronic
1128680326 15:69646897-69646919 CAAGAAATGCACTCAGAGGATGG - Intergenic
1129153732 15:73704664-73704686 CACGAAAAGCACTCTTAGGAAGG - Intronic
1129182674 15:73886973-73886995 CAGGAGCAGCACTCTGGGGAAGG - Intronic
1129740889 15:77989073-77989095 CAGGGAAGGCCTTCTGAGGAGGG + Intronic
1129917605 15:79288146-79288168 CATGAAATGCCCTTTCAGGAAGG - Intergenic
1129952946 15:79608016-79608038 CAGGAACAGCAGGCTGAGGATGG - Intergenic
1130017616 15:80199940-80199962 GAATAAATGCACTCAGAGGAAGG + Intergenic
1130203315 15:81853271-81853293 CAGGAATTTCATTCTCAGGAGGG + Intergenic
1130404540 15:83586243-83586265 GAGGAAAAGCAATCTAAGGAAGG - Intronic
1131101788 15:89696866-89696888 CAGGACAGCCACTCTGAGAAAGG - Intronic
1131850856 15:96541872-96541894 CAGGACATGCACTCTGCAGTTGG - Intergenic
1132540720 16:507807-507829 CGGGAAACGTACTCTTAGGATGG - Intronic
1132540730 16:507888-507910 CGGGAAACGTACTCTTAGGATGG - Intronic
1133843899 16:9436620-9436642 CCACAAATGCACTCGGAGGATGG + Intergenic
1134264788 16:12683720-12683742 CAGGAAGATCACACTGAGGATGG - Intronic
1135277962 16:21129431-21129453 CAAGAAATGCACCCTGGGGCTGG + Intronic
1136078301 16:27832002-27832024 CAGAAAATGCCCACTGAGGAAGG - Intronic
1136112128 16:28070289-28070311 CAGAAAATGCTCTCAGAGGCAGG + Intergenic
1136290503 16:29268610-29268632 CAGGAAAGGCACTCAGAGCCCGG + Intergenic
1137780782 16:51096086-51096108 GATCAAATGCGCTCTGAGGATGG - Intergenic
1140437035 16:74955687-74955709 CAGGAAAGGCAGTCTGCAGAAGG - Intronic
1140526637 16:75628535-75628557 CAGGAAGTGTGCTCTGTGGAGGG + Intronic
1140538533 16:75733519-75733541 AAGAAAATGAACTCTGAAGAAGG + Intronic
1141260592 16:82450038-82450060 CAGCAAACACACTCTGAAGATGG - Intergenic
1141631849 16:85291999-85292021 CAGGAAATCCACCCTCAGCATGG + Intergenic
1142879031 17:2870081-2870103 CACAGAGTGCACTCTGAGGAAGG - Intronic
1144354724 17:14434424-14434446 TAGGAGATGCATCCTGAGGAAGG + Intergenic
1144762919 17:17717487-17717509 GAGGAAATGCACTGAGAGGCAGG - Intronic
1145392850 17:22469486-22469508 CAGGAATTGCAGTCTGGAGAGGG - Intergenic
1148442268 17:47717495-47717517 CAGCAAAAGCACACTGTGGATGG + Intergenic
1148644406 17:49210923-49210945 CAGGACAAGCACTGTCAGGATGG - Intronic
1149699867 17:58646460-58646482 CAGGAGTTGTGCTCTGAGGATGG - Intronic
1151209185 17:72531317-72531339 CATGAAACACCCTCTGAGGATGG - Intergenic
1152068014 17:78122008-78122030 CAGGAAAGGACCTCTGAGCAAGG - Intronic
1152280903 17:79384409-79384431 CAGGAAATGTACTCCCAGGGAGG - Intronic
1152293526 17:79454030-79454052 TAGGAAATGCGCTCTGACAAGGG + Intronic
1152353031 17:79793904-79793926 CAGGAAATGCACTTTAGGGAGGG - Exonic
1152365593 17:79854568-79854590 CAGGGAAGGCTCACTGAGGAAGG + Intergenic
1153674590 18:7445544-7445566 CAGGAACAGTTCTCTGAGGAGGG + Intergenic
1155073729 18:22337771-22337793 CAGGGAAGGAACTCTTAGGAAGG - Intergenic
1156337621 18:36185265-36185287 CACGAATGGCACTCTGAGGAGGG - Intergenic
1157419210 18:47531340-47531362 CTGGAGATGGGCTCTGAGGATGG + Intergenic
1158361665 18:56681067-56681089 CAGGAAATGCAGTCTTATTATGG + Intronic
1158712722 18:59851833-59851855 CAACAAATGGACTCTGAGCAGGG + Intergenic
1159599060 18:70411346-70411368 GAGGAAAGGCCCTATGAGGACGG + Intergenic
1163648525 19:18503787-18503809 CAGGGAAGGCTCCCTGAGGAGGG - Intronic
1164845940 19:31432612-31432634 CAGCAAATGCATTGTGAAGATGG - Intergenic
1168586976 19:57601582-57601604 CAGGTCTTGGACTCTGAGGAAGG + Intronic
925677695 2:6383066-6383088 CAGGAAAGGCAGTCAGAGAAGGG - Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925859809 2:8163412-8163434 AAAGAAAAGCACTGTGAGGAAGG - Intergenic
926434548 2:12824697-12824719 CAGGAGAGACACTTTGAGGAGGG - Intergenic
931049460 2:58394368-58394390 CAGAAAATACACTTTGAAGATGG + Intergenic
931657793 2:64525158-64525180 CAGAAAAGGTACTCTGAGGAAGG - Intronic
932455252 2:71845413-71845435 CAGGAAGGGCCTTCTGAGGAGGG + Intergenic
933204396 2:79488796-79488818 CAGGAGAGGCTTTCTGAGGAGGG - Intronic
933407317 2:81877206-81877228 CTGGAAATGCCTTCTGAGAAAGG - Intergenic
936336575 2:111595456-111595478 CAGGAAGCCCACTCTGCGGAGGG - Intergenic
936715052 2:115176905-115176927 TAGGCAATGCACTGTGAGCATGG + Intronic
937098856 2:119253344-119253366 CAGGAAAAGCACTCAATGGATGG + Intronic
938314428 2:130316122-130316144 AAGGAAAGGCAGTCTGAGGCCGG + Intergenic
939053493 2:137333839-137333861 CAGGAAATGCTCTATGATGATGG + Intronic
939548040 2:143577818-143577840 CAGGAACTGCAGTATAAGGAGGG + Intronic
941272296 2:163445476-163445498 TAGGAAATACAGTCTGAGAACGG - Intergenic
941405500 2:165082855-165082877 AAGGAAAAGCAATCTGAGCAGGG - Intergenic
941710316 2:168705009-168705031 GAGGAAAATGACTCTGAGGAAGG - Intronic
942524000 2:176833576-176833598 AAGCAAAAGCACTCTTAGGAAGG - Intergenic
944636706 2:201681926-201681948 CAGGAAATGCTTACTGAGTAAGG - Intronic
944913445 2:204332943-204332965 CAGGAAATGGAAGCTGAGTAAGG - Intergenic
945489944 2:210442998-210443020 GAGGAACTGCAGTCTTAGGAGGG + Intronic
946329174 2:219000184-219000206 CAGCAACTGCAGTCTTAGGATGG + Intergenic
946531546 2:220576112-220576134 CATGAAAGGCTCTCTCAGGAAGG + Intergenic
946820928 2:223628379-223628401 CAGGAAAACCAGTCTAAGGAAGG - Intergenic
947864502 2:233386890-233386912 CAGGAAGGGCACAGTGAGGATGG + Intronic
1169920365 20:10728433-10728455 CAGGAAATGCACAATGGTGATGG - Intergenic
1170112038 20:12815589-12815611 CAAGAAATGATCTCAGAGGAGGG + Intergenic
1175278343 20:57787139-57787161 CAGGAAAGGCAGTCTGAGGTGGG - Intergenic
1176425131 21:6544044-6544066 CAGGAAGAGCTCTCTGAGGTGGG + Intergenic
1176938356 21:14893598-14893620 TAGGAAATGAAGTCTGGGGAAGG - Intergenic
1179700622 21:43152361-43152383 CAGGAAGAGCTCTCTGAGGTGGG + Intergenic
1181466549 22:23113580-23113602 GAGGAAATCCACTCCAAGGATGG - Intronic
1182038627 22:27219011-27219033 CAGGAAATGGAAGCTGAGGCTGG - Intergenic
1182059491 22:27386833-27386855 CAAGAAATACAGTTTGAGGAGGG + Intergenic
1184094013 22:42306707-42306729 CAGGAAATGGAGGCTCAGGAGGG + Intronic
949789905 3:7781614-7781636 CAGGAAAAGCACTGTGAGGAGGG + Intergenic
950425725 3:12923861-12923883 CAGGAAGAGCACTCAGAGCAGGG - Intronic
951063769 3:18240294-18240316 AAGGAAATGTGCTCAGAGGATGG - Intronic
952827492 3:37536488-37536510 CATGACCTGCTCTCTGAGGATGG + Intronic
952890019 3:38033667-38033689 CAGGAAATACACCCTGAAGCAGG + Intergenic
954277503 3:49552233-49552255 CCAGGAATCCACTCTGAGGAGGG + Intergenic
954864196 3:53715126-53715148 GAGGAAACGCACTCTGACCAGGG - Intronic
956173376 3:66450770-66450792 CAGGAAATTCAGTGTGAAGAGGG + Intronic
958672883 3:97227593-97227615 CAAGACATGCACTTTGAGGGTGG + Intronic
961444174 3:126971320-126971342 CTGGGAATGCACACAGAGGAAGG + Intergenic
962224029 3:133589700-133589722 CAGGAATTGGACTCCGAGGAGGG + Exonic
962895443 3:139709845-139709867 CAGGAAAGGGACTCAGTGGATGG - Intergenic
963835582 3:150055209-150055231 CAGGATATGCTCACTGAGGCTGG + Intergenic
963956326 3:151258436-151258458 CATGAAATGCTATCTGAGGCTGG + Intronic
965313827 3:167165468-167165490 CAGTAAATTCAACCTGAGGAAGG - Intergenic
965404501 3:168252532-168252554 CTGGAAATGCCCTATGAGGTAGG + Intergenic
966902672 3:184498325-184498347 CAGGAAAAGAACACGGAGGAGGG - Intronic
967733026 3:192923578-192923600 AAGGAAATGAACTCTAGGGATGG + Intergenic
970641012 4:18066083-18066105 CACAAAATACGCTCTGAGGAGGG - Intergenic
974805833 4:66879406-66879428 CAGATAATGCATTATGAGGAGGG - Intergenic
974831787 4:67198604-67198626 CAGGAAATGTGCTAAGAGGAAGG - Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
976895399 4:90104099-90104121 TAGGAATTCCATTCTGAGGAGGG - Intergenic
978673035 4:111274174-111274196 CATTAAATACACTCTGAGGCTGG + Intergenic
981929453 4:150174076-150174098 CAGGAAATGAACTCCGGGAATGG + Intronic
981975451 4:150722882-150722904 CAGAAACTGCACTTTGGGGAAGG + Intronic
983300094 4:165914160-165914182 CAGGAAATGCTATCTAATGAAGG - Intronic
984644615 4:182206209-182206231 CAGGAAACCTGCTCTGAGGAGGG - Intronic
985301264 4:188492341-188492363 CTGGGAATGGACTATGAGGAAGG + Intergenic
986041028 5:3994185-3994207 CAGGAAATCCCCACAGAGGATGG + Intergenic
986726439 5:10601561-10601583 CAGGACATTCAGTCTGGGGAAGG - Intronic
986737086 5:10675853-10675875 CAGGAAAGTCACACTGAGGTTGG - Intergenic
987435771 5:17892412-17892434 CAGGAAAGGCCCTCTGGAGAAGG + Intergenic
988130484 5:27097486-27097508 GAGGAAATGTACTATGAGGTGGG - Intronic
990310766 5:54535843-54535865 CTGGAGATGCCCTCTGGGGAAGG - Intronic
993075842 5:83229502-83229524 CTGGAAATGCATTCAGAGCAGGG - Intronic
993188455 5:84650328-84650350 CAGGAAATTTAGTTTGAGGATGG - Intergenic
993421430 5:87706162-87706184 CATGACATGGACTCTGAGGATGG + Intergenic
994013948 5:94943227-94943249 CAGGAACTCCTCTCTGAGGAAGG + Intronic
995466261 5:112452187-112452209 CAGGGCATGCACTGTGAGGCTGG - Intergenic
995956168 5:117778964-117778986 CTGGAAATGCTTTCTTAGGAAGG + Intergenic
996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG + Intergenic
997206872 5:132055333-132055355 CAGGAAATGCTCTCTTAAGTGGG - Intergenic
998016099 5:138733638-138733660 CAGGAAAGGCATTTTGAGGAAGG + Intronic
999044161 5:148449562-148449584 AAGAGAATCCACTCTGAGGAGGG + Intergenic
999856987 5:155605762-155605784 GAGGAAATGGATTCTGAAGAGGG + Intergenic
1003961009 6:11209525-11209547 TAGGAAATAAACTCTGAGAAAGG + Intronic
1004107438 6:12678774-12678796 TAGAAAATGCACCCAGAGGATGG + Intergenic
1004529058 6:16436707-16436729 CAGGAAATGAAGTCAGAGGGTGG + Intronic
1005610048 6:27514974-27514996 CAGGAAAGGCAGTCTGCAGAAGG - Intergenic
1007851205 6:44804293-44804315 GAGGAAATGCAGCCTGAGGGTGG - Intergenic
1008033186 6:46719812-46719834 GAGTAAATGGACTCTGGGGAAGG - Intronic
1008152520 6:47971692-47971714 CATGGAGTGCATTCTGAGGAAGG - Intronic
1009445065 6:63732979-63733001 CAGGAAAGGCATTATGAAGAAGG + Intronic
1010588387 6:77682836-77682858 CAGAAAAGGCATTCAGAGGAAGG + Intergenic
1011755731 6:90496743-90496765 CAAGAAATCCCATCTGAGGAAGG + Intergenic
1012542063 6:100372664-100372686 CAGGAAAGCCACACGGAGGATGG + Intergenic
1015186685 6:130425015-130425037 CAGAAAAAGAACTCTGGGGATGG - Intronic
1016534165 6:145091984-145092006 ATGGAAGTGCACTCTGAAGAGGG - Intergenic
1018344402 6:162885862-162885884 TAGGAAATGCACTCTAAGACAGG - Intronic
1018406942 6:163495493-163495515 TAGGAAATGCACTCTAAGACAGG - Intronic
1018469668 6:164084235-164084257 GAGGACATGGACTCTGAGGCGGG - Intergenic
1018957166 6:168418043-168418065 CAGCAAATTCACGCAGAGGAGGG + Intergenic
1019077885 6:169405072-169405094 CAGCAGCTGCAATCTGAGGAGGG - Intergenic
1019165809 6:170097002-170097024 CAGAAAATACACTGGGAGGAGGG + Intergenic
1019176781 6:170163466-170163488 CAGGGAAAGCACTGTGGGGACGG + Intergenic
1020724969 7:11800622-11800644 CAGTAAATGCCCTCTGAGGCTGG - Intronic
1021550751 7:21868743-21868765 CAGGAAAGTCACTCAGAAGATGG + Intronic
1021680704 7:23128338-23128360 CAGGAACTGCAGTGTGAGGTAGG + Intronic
1022077066 7:26982250-26982272 CAGGATATGCACTGTGAGGCTGG - Intronic
1022287262 7:28965445-28965467 CAGGAAAGGAAATCAGAGGAAGG + Intergenic
1022661495 7:32371512-32371534 CAGTAAATGCTCGCTGAGTAAGG - Intergenic
1023834517 7:44060417-44060439 CAGAACATGGACTCTGAGCAGGG + Intronic
1024410680 7:49037828-49037850 CAATAAATTCACCCTGAGGAAGG + Intergenic
1024754008 7:52506753-52506775 CATTAAATGTACTCTGGGGAAGG - Intergenic
1027599294 7:80219578-80219600 CAGGCAATGCATTCTCAGAAGGG - Intergenic
1028362553 7:89986577-89986599 AAGGAAATGAACTCTGTTGAAGG + Intergenic
1028898048 7:96064051-96064073 CAGTAAATGTATTCTGAAGATGG - Intronic
1029927781 7:104335935-104335957 CAGGAGATGAACTATGGGGAGGG + Intronic
1030270449 7:107663589-107663611 CAGGAAGAGAACTCTAAGGAAGG - Intronic
1030520608 7:110593643-110593665 CATGGAATGCAATGTGAGGAAGG - Intergenic
1031490714 7:122384253-122384275 AAGGGAATGCATTGTGAGGAAGG + Intronic
1031869091 7:127073011-127073033 CAGGAAAAACTCTCAGAGGAGGG + Intronic
1032622693 7:133553461-133553483 CAGGGAATGAAATCGGAGGAAGG - Intronic
1033093356 7:138407127-138407149 CAGGAAAAGCACCCTGAGCTTGG + Intergenic
1033658711 7:143389672-143389694 CAGGAAATTCCCTTTGATGAGGG + Intronic
1035374282 7:158397228-158397250 CAGGAGATGCCCTCCGAGGTAGG + Intronic
1037152562 8:15655566-15655588 AAGGAAGTGCACTTGGAGGAAGG - Intronic
1037504274 8:19515107-19515129 CAGGAAAGGCACTCTGAGGCTGG - Intronic
1037554519 8:20009242-20009264 CAGGAAATCCCCTATGAGGGGGG + Intergenic
1040891065 8:52316641-52316663 TAGGAAATGTAATGTGAGGATGG - Intronic
1041066388 8:54086272-54086294 CAGGGACTGTACACTGAGGAAGG + Intronic
1042999940 8:74745689-74745711 AAGGAAAAGCACTATGTGGATGG + Intronic
1044218906 8:89646729-89646751 CAGAAAAGGCAATCTGATGATGG + Intergenic
1045053006 8:98343670-98343692 CAAGAAAAGCACTCAGAGCAAGG + Intergenic
1045255015 8:100512154-100512176 CAGAAACTGCATTCTGAGTAAGG + Intronic
1047260130 8:123249582-123249604 CAGGAAATTAATTCTGAAGAAGG - Exonic
1048663339 8:136632481-136632503 CAGGAAATGCACACCAAGGGTGG + Intergenic
1048892776 8:138962732-138962754 CAGGAAATGGAGACTGAGAAAGG - Intergenic
1049018109 8:139935919-139935941 CTGGAAATGCAGTGTCAGGATGG + Intronic
1049206634 8:141366646-141366668 CAGGACGGGCACTCTGAAGAGGG + Intronic
1051148745 9:14058338-14058360 CAGGGCATGCACGCTGAGCAGGG + Intergenic
1052556707 9:30027799-30027821 AAGGATATCCACTCTGATGAAGG + Intergenic
1054867825 9:70020623-70020645 CTGGAAAAGCCCTCGGAGGAGGG - Intergenic
1055144652 9:72918774-72918796 CGGGAAAAGCAATCTGAAGAGGG - Exonic
1056015016 9:82376392-82376414 GAGGAATTGCACTTTGAGGAGGG + Intergenic
1056723272 9:89089622-89089644 AAGGAAATAAACTCAGAGGAGGG + Intronic
1056825255 9:89872595-89872617 CAGGGACTGCACTCTGCGTAGGG + Intergenic
1057305910 9:93912022-93912044 CACAAAATCCACTCTGAGGCGGG + Intergenic
1057588214 9:96348350-96348372 AAGGAAGTGCCCTCTGAGGCAGG + Intronic
1058862074 9:109126310-109126332 CAGGACCTGCACTGTGAGTAGGG - Intergenic
1060543734 9:124448536-124448558 CAGGAAGGGCACGGTGAGGAGGG + Intergenic
1061367600 9:130180725-130180747 CAGTAAATGCTCTCCCAGGAAGG + Intronic
1061876875 9:133548474-133548496 CAGAAAATAGACTCTGAGGTGGG + Intronic
1061932445 9:133840206-133840228 GAGGAAATGCATGCTCAGGAAGG - Intronic
1062167687 9:135116152-135116174 GAGGGAATGAACTCAGAGGAGGG + Intronic
1187933119 X:24311833-24311855 CAGGAAATGGACGCTTAAGAGGG + Intergenic
1189909869 X:45799683-45799705 CAGGAAGAGCATTCTGAGAAAGG + Intergenic
1193176185 X:78396708-78396730 CAGTAAAAGCAGTCTTAGGAGGG + Intergenic
1193694744 X:84694795-84694817 GCAAAAATGCACTCTGAGGAGGG + Intergenic
1197178813 X:123512353-123512375 CAGCAAATCCAGTCTGAGAAGGG + Intergenic
1198366166 X:135941914-135941936 CAGGAAATGAAGTATGAGAATGG + Intergenic
1199551116 X:149062361-149062383 CAGGCAATGATCTCTGAGGCAGG + Intergenic
1199653393 X:149970453-149970475 CTGGAAGTGCACTCTGGGAAAGG - Intergenic
1200150460 X:153948934-153948956 CAGGAAAGCCACTCTGGGGAGGG + Exonic
1201038516 Y:9806375-9806397 CACGAAATGCACTTTAATGAGGG - Intergenic
1201148157 Y:11077858-11077880 GTGAAAATGCAGTCTGAGGATGG + Intergenic