ID: 909950693

View in Genome Browser
Species Human (GRCh38)
Location 1:81716711-81716733
Sequence CCCTTTTATGCTCCTTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909950693_909950696 13 Left 909950693 1:81716711-81716733 CCACCAAAAGGAGCATAAAAGGG 0: 1
1: 0
2: 2
3: 13
4: 193
Right 909950696 1:81716747-81716769 AATATATATTCTGAAAAGTATGG 0: 1
1: 1
2: 5
3: 68
4: 664
909950693_909950697 21 Left 909950693 1:81716711-81716733 CCACCAAAAGGAGCATAAAAGGG 0: 1
1: 0
2: 2
3: 13
4: 193
Right 909950697 1:81716755-81716777 TTCTGAAAAGTATGGACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909950693 Original CRISPR CCCTTTTATGCTCCTTTTGG TGG (reversed) Intronic
900531599 1:3156487-3156509 CCATTTTGTCCTTCTTTTGGGGG - Intronic
901141280 1:7033971-7033993 CGCTTTTATGCTTTTTTAGGTGG + Intronic
901246328 1:7734337-7734359 TCCTTTTATGCCACTTTTGTTGG - Intronic
904937002 1:34138168-34138190 CCCTTTTATGATCCTTCTGGGGG + Intronic
907212853 1:52838248-52838270 CCTTTTTTTCCTCCTTTTTGTGG + Intergenic
909950693 1:81716711-81716733 CCCTTTTATGCTCCTTTTGGTGG - Intronic
910866388 1:91792011-91792033 CCCTTTTTTGGTTCTTTTTGAGG - Intronic
911675636 1:100655482-100655504 CCTTTTTATGCTCCTTTTGTTGG - Intergenic
912526192 1:110284917-110284939 CCCTTATATGCTGGTTTTGGAGG - Intergenic
920296699 1:204961896-204961918 ACCTTTTTTTCTCCTTTTGTGGG + Intronic
922657321 1:227397031-227397053 CCCTCTTATGCTCACTATGGTGG + Intergenic
1065688394 10:28308510-28308532 CCCTTTTATGATCCTATTTTGGG + Intronic
1071281867 10:84110833-84110855 CCCTTTCCCTCTCCTTTTGGGGG - Intergenic
1071955034 10:90748777-90748799 CCCTTTTATGCAGCTTTTTGAGG - Intronic
1072515360 10:96176326-96176348 CCCTTTTCTCCTCCTTTTCTGGG - Intronic
1073031975 10:100533828-100533850 TCCTTATATGCTTTTTTTGGGGG + Intronic
1073411652 10:103347152-103347174 CCCTTTGAAGTTCCTTTTGGGGG - Intronic
1074192808 10:111152275-111152297 GCCTTTTGTGCTCCCTTTGCTGG + Intergenic
1075809673 10:125215877-125215899 CCCTTTTATGCTCATGATGGTGG + Intergenic
1077825540 11:5804964-5804986 CTTTTTTATGCTCCTATCGGGGG + Intronic
1078201169 11:9184636-9184658 CCATTTTATGCTCATTTTGTTGG - Intronic
1078936759 11:15958155-15958177 CCCATTTCTCCTCCTTCTGGAGG + Intergenic
1081229415 11:40565760-40565782 ACATTTTTTGCTCCTTTAGGTGG - Intronic
1083363444 11:62127475-62127497 TCTATTTATGCTCCATTTGGAGG + Intronic
1085242110 11:75066127-75066149 CATTTTTATGCTCTTTTTGTTGG - Intergenic
1085418698 11:76337259-76337281 CCCATTTTGGGTCCTTTTGGAGG - Intergenic
1086107213 11:83158267-83158289 AACTTTTATTCTCCTATTGGAGG + Intronic
1088836018 11:113578447-113578469 CCCTTCTGTGCTCCCTTTGCTGG - Intergenic
1090461795 11:126897506-126897528 TCCTGTTCTACTCCTTTTGGGGG - Intronic
1092275718 12:7059639-7059661 CCCCTTTATGCCCCTTTAGTTGG - Intronic
1092601171 12:10066583-10066605 CCTTTTTTTGCTCCTCTTGGAGG + Intergenic
1093251518 12:16810523-16810545 TCCTTTTATATTCCTTTTGCAGG + Intergenic
1097100021 12:56581166-56581188 CCCTCTTATGCTCCTTAGGATGG + Exonic
1097247987 12:57617122-57617144 CCCACATATCCTCCTTTTGGGGG - Exonic
1098531630 12:71547983-71548005 CCACTTTATGGTCCTTTTGGGGG - Intronic
1102873394 12:116431482-116431504 CCCTTTTATGTTCCTTCTCTAGG + Intergenic
1104203356 12:126613778-126613800 CTTTGTTATGCTCCCTTTGGGGG + Intergenic
1105225819 13:18430579-18430601 CCTTGTTATGCTCCCATTGGGGG - Intergenic
1106666566 13:31857354-31857376 TCCTTGTATTCTACTTTTGGCGG - Intergenic
1107587025 13:41861557-41861579 CACTTTTAGGAGCCTTTTGGTGG - Intronic
1108082849 13:46755200-46755222 CCCTTTTATCCTGCTCTTTGTGG - Intergenic
1109802646 13:67399575-67399597 CCCTTTCCCTCTCCTTTTGGGGG - Intergenic
1110978246 13:81867021-81867043 CCCTTTTCTGCTTTTTTGGGTGG + Intergenic
1112502938 13:99956386-99956408 CCCTTTTGTGCTCGTTTTGCAGG + Intergenic
1112738452 13:102447306-102447328 CCCTTGTATGCTAATTTTGCTGG - Intergenic
1113283431 13:108816680-108816702 ACCTTTTATGCACCTTGAGGCGG - Intronic
1113863256 13:113504659-113504681 CCCTTTTTTGTTCCTTTTTATGG + Intronic
1114010273 14:18358929-18358951 CCTTGTTATGCTCCCATTGGGGG - Intergenic
1114161874 14:20177453-20177475 GCCTTTTATGCACCTTGAGGCGG + Intergenic
1115033117 14:28822375-28822397 CCATTTTGAGCTCCTTTTTGTGG - Intergenic
1117221726 14:53612746-53612768 CCCTTTTCGGCACCTTTTGTGGG - Intergenic
1119546611 14:75476617-75476639 CCCTTTTATTCTCCAGGTGGAGG + Intergenic
1121678739 14:95775450-95775472 GCCTATTATGGTCCTTTTTGAGG + Intergenic
1123431551 15:20221620-20221642 CCCTTTTCTGCTGCTATCGGGGG + Intergenic
1126878334 15:53067942-53067964 TTCTTTTACTCTCCTTTTGGTGG + Intergenic
1130178606 15:81602030-81602052 CTCTTTTATAATTCTTTTGGTGG - Intergenic
1130856192 15:87841725-87841747 CCCTCCCATGTTCCTTTTGGAGG + Intergenic
1131595284 15:93792201-93792223 CCCTTTCTTGATCCTTGTGGAGG + Intergenic
1133944570 16:10337552-10337574 CCCTTTTAGGTTCTTTTGGGTGG + Intronic
1134831837 16:17330318-17330340 ACCTGTTCTGCTCCTTCTGGGGG - Intronic
1136853100 16:33629608-33629630 CCCTTTTCTGCTGCTATCGGGGG - Intergenic
1203114694 16_KI270728v1_random:1478030-1478052 CCCTTTTCTGCTGCTATCGGGGG - Intergenic
1143125842 17:4640530-4640552 CCCTTTTTTCCTCCCTATGGTGG - Intronic
1143402636 17:6656292-6656314 CCCTTTTTTCCTCCCTATGGTGG + Intergenic
1143732490 17:8888940-8888962 CCCTTCTATATTCCCTTTGGAGG + Intronic
1144625984 17:16844721-16844743 CTCCTTTAGCCTCCTTTTGGGGG - Intergenic
1144880450 17:18427999-18428021 CTCCTTTAGCCTCCTTTTGGGGG + Intergenic
1145151785 17:20516388-20516410 CTCCTTTAGCCTCCTTTTGGGGG - Intergenic
1145710906 17:26975265-26975287 AGCCCTTATGCTCCTTTTGGTGG + Intergenic
1146163155 17:30570673-30570695 CTCCTTTAGCCTCCTTTTGGGGG - Intergenic
1146266837 17:31458423-31458445 CCCCTTCCTGCTGCTTTTGGAGG + Intronic
1146785362 17:35715681-35715703 CCCTTTTAATCACCTTGTGGGGG - Intronic
1147580134 17:41623419-41623441 CTCCTTTAGCCTCCTTTTGGGGG - Intronic
1149342763 17:55703523-55703545 CCCTGTTATGTTATTTTTGGTGG + Intergenic
1149734704 17:58981736-58981758 ACCTGTTATGGTGCTTTTGGTGG + Exonic
1150012519 17:61518487-61518509 CCCTTTTATTCTGCATTTTGTGG - Intergenic
1151845992 17:76655851-76655873 CCCATGTACTCTCCTTTTGGAGG + Intergenic
1152278399 17:79371413-79371435 CCCTTTCCTGCTCCCTGTGGGGG + Intronic
1152928609 17:83099108-83099130 CCCTTCTTTGCTCCTTTGTGCGG + Intergenic
1154527556 18:15308942-15308964 CCTTGTTATGCTCCCATTGGGGG + Intergenic
1156195330 18:34768307-34768329 CCTTTTTTTGCTTTTTTTGGGGG - Intronic
1156437269 18:37146041-37146063 TCCTTTTCTGCTCCTTTTTTTGG + Intronic
1158720895 18:59923523-59923545 CCCTTTTATGTTTGTTTTTGGGG - Intergenic
1159442884 18:68504408-68504430 TCCTTTGATGCTCTTTTTTGCGG - Intergenic
1162284561 19:9728496-9728518 CCCTTTCCCTCTCCTTTTGGGGG + Intergenic
1163878750 19:19899455-19899477 CCTTCTTATGTTCCTATTGGGGG - Intergenic
1163943565 19:20516178-20516200 CCCTTTCCCTCTCCTTTTGGGGG + Intergenic
925746951 2:7051519-7051541 CTCTTCGCTGCTCCTTTTGGCGG - Intronic
926071654 2:9898980-9899002 CCATTTTATACTTTTTTTGGTGG + Intronic
926981778 2:18580166-18580188 CACTTATATGCTGCTTTTGGGGG + Intronic
930071484 2:47369651-47369673 CCCTATTATGCCCGTTTCGGGGG - Intronic
931844031 2:66184218-66184240 TCCTTTGATGCTCCTTTTTCTGG - Intergenic
932433819 2:71691517-71691539 CCATTTTCTGCTCCTTTTCCAGG + Intergenic
932433831 2:71691608-71691630 CCATTTTCTGCTCCTTTTCCAGG + Intergenic
933140988 2:78792720-78792742 CCCTTACATGGACCTTTTGGAGG - Intergenic
933342331 2:81038834-81038856 CCCTGTTCTTCCCCTTTTGGTGG - Intergenic
934898333 2:98138278-98138300 CCCTTTTAGGCTGCTTGTTGAGG + Intronic
937927676 2:127179663-127179685 CCCTTTGATGATCCTCTTTGTGG - Intergenic
938526652 2:132140399-132140421 CCTTGTTATGCTCCCATTGGGGG + Intergenic
940859105 2:158753934-158753956 CCCTTTTCTCCTCCCCTTGGTGG + Intergenic
942635309 2:177997789-177997811 CCATTTTCTGCTTCTTCTGGAGG + Intronic
943606475 2:189983165-189983187 CCTTATTATGCTCCTGTTGCAGG + Intronic
944698321 2:202223289-202223311 CCCTTTTTTGTTTCTTTTTGTGG + Intronic
945418112 2:209600089-209600111 CCCTTCAATGCTCCTTTTATAGG - Intronic
945483242 2:210366274-210366296 CCTTGTTATGCTCCTAGTGGGGG + Intergenic
946320709 2:218952748-218952770 CCCTTTTCTGGTCCTGTTGCAGG - Intergenic
1169251021 20:4061145-4061167 ACCTTTTCTGCTCCATTCGGTGG - Intergenic
1169916281 20:10686831-10686853 CTTTCTTATCCTCCTTTTGGTGG - Intergenic
1170024461 20:11873957-11873979 CCTTTTCATGCTCCTGTTGTGGG + Intergenic
1170775765 20:19373415-19373437 CCCTTTTCTCTACCTTTTGGAGG + Intronic
1174764591 20:53240865-53240887 CTGTTTCATTCTCCTTTTGGGGG - Intronic
1176417252 21:6483856-6483878 CCCTGCTCTGCTCCTTGTGGGGG - Intergenic
1176769874 21:13059602-13059624 CCTTGTTATGCTCCCATTGGGGG - Intergenic
1179208177 21:39303190-39303212 TCCTTTTATTATTCTTTTGGTGG - Intronic
1179692748 21:43092189-43092211 CCCTGCTCTGCTCCTTGTGGGGG - Intergenic
1180434769 22:15289730-15289752 CCTTGTTATGCTCCCATTGGGGG - Intergenic
1182690968 22:32162302-32162324 CCCTTTTATGGTCTCTTTTGTGG - Intergenic
1183224748 22:36541935-36541957 CCATTTTATCATCCTGTTGGAGG + Intergenic
1183421457 22:37713952-37713974 CCCTGTCATTTTCCTTTTGGGGG - Intronic
1184617754 22:45649617-45649639 CCCCTTTATTCTCATTTTGCAGG + Intergenic
1185175376 22:49323307-49323329 CACATTCATGCTCCTTATGGAGG - Intergenic
949430480 3:3970359-3970381 CTCTTTTATGTTCATTTTTGGGG - Intronic
949498351 3:4654918-4654940 CCCTTTTGTGCTCCTTACTGGGG + Intronic
949702964 3:6780499-6780521 CTCAGTTATGCTCCTTGTGGTGG - Intronic
949906841 3:8864841-8864863 CCCTTTTATGCCCCTCTTTTCGG - Intronic
951363356 3:21750991-21751013 CCCTTTCATGCTACATTCGGTGG + Exonic
952992105 3:38839991-38840013 CCCTTTTATGCCCAATTTGCTGG + Intergenic
955083695 3:55681197-55681219 CCCTTTTTTGCCACTTCTGGAGG - Intronic
957257584 3:77857956-77857978 CCCTTTTATGCCCTTCTTTGTGG - Intergenic
961407308 3:126689745-126689767 CCCTTGTATGCTGATTTTGCTGG + Intergenic
961425739 3:126846104-126846126 CCTTTTTCTGCCCCTTCTGGTGG - Intronic
961717654 3:128869742-128869764 CCCATTTCTGCCCCTTCTGGAGG - Intergenic
964941158 3:162158828-162158850 CCCTTTTCTGCTCTTCTGGGGGG - Intergenic
965549224 3:169947337-169947359 TCTTTTTGTGCTCCTTTTTGGGG + Intergenic
966485720 3:180467472-180467494 CTATTTTATGCTTCTTTTGATGG + Intergenic
967493633 3:190120387-190120409 CCCTTTTCCGCTCCTTGTTGGGG - Exonic
970283971 4:14488539-14488561 CCCTTCTATGCTGATTTTGCTGG - Intergenic
971379198 4:26081363-26081385 CCATTTTGTGCCCATTTTGGAGG - Intergenic
972115771 4:35631944-35631966 TCTTTTTGGGCTCCTTTTGGAGG + Intergenic
973022037 4:45215713-45215735 TCTTTTTAGGGTCCTTTTGGAGG + Intergenic
976168806 4:82282906-82282928 CACTTTTTTGGTCCTCTTGGAGG - Intergenic
977316793 4:95460155-95460177 GCATTTTATGCTCTTGTTGGTGG + Intronic
977957509 4:103047168-103047190 GCCTTCAATGCTCCTTTTGCAGG - Exonic
979031248 4:115650863-115650885 CTCTTTTTTCCTCCTTTTTGCGG + Intergenic
979498828 4:121415492-121415514 CCCTTGTATGCTGATTTTGCTGG + Intergenic
979919034 4:126476031-126476053 GGCTTTTATGGTCCATTTGGTGG - Intergenic
981886957 4:149687919-149687941 CCCTTGTATGCTGATTTTGCTGG - Intergenic
984542126 4:181052191-181052213 TCTTAATATGCTCCTTTTGGAGG - Intergenic
984695122 4:182771262-182771284 CCCTTTTTTGACCCTTTTGCTGG - Intronic
985645944 5:1084831-1084853 CTCTTTTCTTGTCCTTTTGGAGG - Intronic
988731366 5:33976260-33976282 CACTTTAATGATCTTTTTGGGGG - Intronic
991048798 5:62250629-62250651 CCCTTTTCTGCTGCTATCGGGGG + Intergenic
991932053 5:71763123-71763145 TCTTTCTATGCTCCTTGTGGGGG + Intergenic
991938788 5:71830136-71830158 CCCTTAAATCCTCTTTTTGGGGG - Intergenic
995350114 5:111165171-111165193 CTCTTTTATTCCCCTTATGGAGG + Intergenic
995599774 5:113782656-113782678 CTCTTGTATACTACTTTTGGGGG + Intergenic
995643322 5:114282634-114282656 CCTTTTTATACTGCTTTTGTTGG + Intergenic
996288167 5:121819907-121819929 CCCTTTAATGGCCCTTTGGGAGG - Intergenic
997333083 5:133081536-133081558 ACCTTTTATACTTGTTTTGGAGG + Intronic
1004716300 6:18219434-18219456 ATCTCTTATGCTACTTTTGGGGG + Intronic
1006233718 6:32608715-32608737 ACCTTTTGTACCCCTTTTGGAGG + Intergenic
1007659779 6:43477010-43477032 CCCTTTAGTGCTCCTTTTGCTGG - Intergenic
1008118930 6:47587830-47587852 CCATTTTATGCTCTTTCTGTGGG - Intronic
1008768737 6:54952381-54952403 ACCTTTTATGCTTTTTTTGGGGG - Intergenic
1008888755 6:56460511-56460533 CACTTTTATGCTCAGTTTTGGGG - Intronic
1009381665 6:63039149-63039171 CTGTTTTATTATCCTTTTGGTGG - Intergenic
1012942541 6:105430661-105430683 CCCTTTGATGCTGCTGTTGAAGG + Intergenic
1015322585 6:131892857-131892879 CCCTTTTCTGGTCCTTTGGCAGG + Exonic
1017757755 6:157544037-157544059 CCCATTTAAGCCCCTCTTGGGGG - Intronic
1018541192 6:164881702-164881724 CCCTTTTCTGGTCTTTTTGCTGG + Intergenic
1021859814 7:24895137-24895159 ACTTTTTAGGCTGCTTTTGGTGG - Intronic
1022618716 7:31959725-31959747 CCCTATTATGCTTCTTAAGGAGG + Intronic
1024628517 7:51229071-51229093 GCCCTTTGTGCTCCTTTTAGGGG - Intronic
1033135261 7:138778806-138778828 CCCTTGTTTGCCCCTGTTGGGGG + Intronic
1033611783 7:142970294-142970316 CCTTTTCCTGCTCCTTTTGCTGG - Intergenic
1034404758 7:150896080-150896102 CCAGTTTATGCACCTTGTGGTGG + Intergenic
1035575695 8:703286-703308 CCCACTTATTCTCATTTTGGTGG - Intronic
1036896082 8:12636554-12636576 CCCTTTGGTGCTCCCTTCGGTGG + Intergenic
1037396533 8:18449650-18449672 CCCTTTTATGAAGCCTTTGGAGG - Intergenic
1037944015 8:22975206-22975228 CCCTCTGATGCTGCTCTTGGTGG + Intronic
1043314509 8:78903419-78903441 CCTTTTAATTATCCTTTTGGAGG - Intergenic
1044161491 8:88922487-88922509 CTATTTTTTGTTCCTTTTGGAGG - Intergenic
1045063003 8:98424755-98424777 CCTTTTTCTGCTGCATTTGGAGG - Intronic
1045780146 8:105853365-105853387 CCCTTGTATGCTGATTTTGCTGG - Intergenic
1046181594 8:110656068-110656090 CCCTATTATGCCCCTGTTGCAGG - Intergenic
1048139475 8:131779260-131779282 CCCTTTTTTTCTTTTTTTGGGGG + Intergenic
1049456078 8:142690047-142690069 TCCTTTTTTTCTCCTTTTGCTGG + Intergenic
1051396000 9:16621300-16621322 CCCTCTGTTTCTCCTTTTGGAGG - Intronic
1051764543 9:20508364-20508386 CACTTTCATTCTCCTTTTAGTGG - Intronic
1053705358 9:40747757-40747779 CCTTGTTATGCTCCCATTGGGGG + Intergenic
1054415434 9:64871364-64871386 CCTTGTTATGCTCCCATTGGGGG + Intergenic
1054905307 9:70409363-70409385 CCATCTTATTCTCTTTTTGGAGG - Intronic
1055419883 9:76128132-76128154 CCCTTTTCTGCTCATTTTGTGGG - Intronic
1057948367 9:99349735-99349757 CCCTTTTATGCTCTTTTCCTTGG - Intergenic
1059096812 9:111425239-111425261 CCCTTTTTTGCTTTTTTGGGGGG - Intronic
1059291444 9:113228298-113228320 CCCTTTCATGCTCCTCTTACAGG - Intronic
1059548333 9:115201684-115201706 CCCTTTCATGGACCTTTTGTAGG + Intronic
1060238188 9:121881124-121881146 GCCTTTTCTGCTAATTTTGGAGG - Intronic
1061696078 9:132374557-132374579 AAATTTTATGTTCCTTTTGGAGG - Intergenic
1186818733 X:13264494-13264516 CCTTTTCATGCTCCTTTGGTGGG + Intergenic
1187535673 X:20139801-20139823 ACCTTTTACTCTCTTTTTGGAGG - Intronic
1187958715 X:24546499-24546521 TCATTTTATTTTCCTTTTGGGGG - Intergenic
1188431865 X:30112440-30112462 TCCTTTTATTATCTTTTTGGGGG + Intergenic
1189946409 X:46184569-46184591 CCTTTTTATGGTCTTTTTTGTGG + Intergenic
1190916502 X:54815148-54815170 TCCTCTTATGCTCCTTCTGATGG + Intronic
1193668013 X:84348063-84348085 CCCTTTTTTTCTCTTTCTGGTGG + Intronic
1196477644 X:116107454-116107476 CCATTTTCTGCTTCTTCTGGAGG + Intergenic
1197112598 X:122794409-122794431 CTCTTTTATCCTTCTTTTGAAGG + Intergenic
1198417960 X:136439912-136439934 CACTTTTATTCTCCTTTTTGGGG - Intergenic