ID: 909951339

View in Genome Browser
Species Human (GRCh38)
Location 1:81723485-81723507
Sequence TTCCTTTGAATTATTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 2, 1: 8, 2: 4, 3: 13, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909951339 Original CRISPR TTCCTTTGAATTATTGGGCA GGG Intronic
902110437 1:14074074-14074096 TTCCTTTGTACTATTGTCCAGGG - Intergenic
902707231 1:18213883-18213905 GGCCTTTGAAGTGTTGGGCAGGG - Intronic
903099678 1:21018092-21018114 TTTTTTTTAATTACTGGGCATGG - Intronic
903105409 1:21074614-21074636 TGCGTTTGAATTATTTGGTATGG - Intronic
906494910 1:46298343-46298365 ATGCTTTGAAGTATTGGGCCTGG + Exonic
909951339 1:81723485-81723507 TTCCTTTGAATTATTGGGCAGGG + Intronic
911095399 1:94050858-94050880 TTACTTTGTATTATTGGGCCTGG - Intronic
911483547 1:98476051-98476073 TGACTATGAATTATTGGGAAGGG - Intergenic
915169647 1:153968832-153968854 GTCCTTTCACTTCTTGGGCATGG - Intronic
915954459 1:160210756-160210778 TTGCTTGGTATTCTTGGGCACGG + Intronic
917109385 1:171529607-171529629 TTCCTTTGAACTATTGGAGTGGG + Intronic
918064827 1:181093156-181093178 TTTGCTTGAATTATTGCGCATGG + Intergenic
923367800 1:233280246-233280268 TCCCTTTGAATTCTTGAGAATGG + Intronic
923764334 1:236879161-236879183 TTCCTCTGAATTGTTTGACATGG - Intronic
924288965 1:242518523-242518545 GTCCTTTGAATTCTGGGACATGG - Intronic
1066566409 10:36726019-36726041 TTCCATTAAATTAGTGGGAAAGG - Intergenic
1072029086 10:91499789-91499811 TTCATTTGAATTATTTTTCATGG + Intronic
1074273121 10:111974602-111974624 TACTTTTGAATTAGTGGTCAGGG - Intergenic
1079189153 11:18263406-18263428 TTTCCTTAAATTATTGGGCAGGG + Intergenic
1079309481 11:19351779-19351801 TTCCTTTGAAATGTTGTGTATGG + Intronic
1079674377 11:23206916-23206938 ATTCTTTGAATAATTGGGAATGG + Intergenic
1080361346 11:31517452-31517474 TTCCTTTGATAGGTTGGGCACGG - Intronic
1080525232 11:33109877-33109899 TTCCTTTGAATTTTTGCTCAAGG + Intronic
1080930088 11:36800798-36800820 TTCATTTGAATACTTGAGCAAGG - Intergenic
1085047134 11:73360170-73360192 TTCCTTTGATATATGGGGGATGG - Intronic
1085906153 11:80765744-80765766 TTTATTTGAATAATTGGGAAAGG + Intergenic
1087156988 11:94914459-94914481 TGTATTTGAATTATTGGGCAGGG + Intergenic
1088683654 11:112266976-112266998 TTTCTTTAAATTATTGGGCAGGG - Intronic
1091276119 11:134351981-134352003 TCCCTTTCAATTTTTGGGAAGGG + Intronic
1092968044 12:13664218-13664240 TTAGTTGCAATTATTGGGCATGG + Intronic
1094389016 12:29928705-29928727 TTCCTATGCATTAATTGGCATGG + Intergenic
1095412106 12:41935521-41935543 TTTCATTGATTTATTGAGCATGG - Intergenic
1096525836 12:52209744-52209766 TTCCTGTGTGATATTGGGCAAGG - Intergenic
1097297518 12:57983451-57983473 TTTATTTGAATTATTGGGCAGGG - Intergenic
1100136741 12:91562273-91562295 TCACTTTGAAGTATGGGGCAAGG + Intergenic
1101578208 12:106017323-106017345 TTTCTTTGAATTATTGGGCAGGG + Intergenic
1101579629 12:106031306-106031328 TTCCTCTCAAATATTTGGCATGG + Intergenic
1103455341 12:121060700-121060722 TTCCTGTGGATTATTGGTGAGGG - Intergenic
1104739356 12:131161579-131161601 TTTCTTTGAAGTATTAGGAATGG + Intergenic
1105947300 13:25201271-25201293 TTCCTTTGGAACACTGGGCAAGG - Intergenic
1108413464 13:50173505-50173527 TTTCTTTGAATTATTGGGCAGGG + Intronic
1109834024 13:67831507-67831529 TTTCTTTGAATTGTTTGGCATGG + Intergenic
1109889381 13:68588586-68588608 TTCCTTTTAATTTTTGTGCATGG - Intergenic
1113119821 13:106914124-106914146 TTTCGGTGAATTATTGGGAAAGG - Intergenic
1113308166 13:109100987-109101009 TTCCTTTGATGTGTTTGGCAAGG + Intronic
1116282078 14:42921668-42921690 TTCCTTTGTAGTATTGGGTTTGG + Intergenic
1117602193 14:57387779-57387801 TTCCTATGAAGTATTGCTCATGG + Intergenic
1119078373 14:71667661-71667683 TTCCTTTTAAATTTTGGGCTGGG + Intronic
1120245682 14:82003554-82003576 TTCCTTTGATTTCTTTGGCTAGG + Intergenic
1120581721 14:86258847-86258869 TTCTTTTGAATTGATGTGCATGG + Intergenic
1120739835 14:88095892-88095914 TGCCTGTGTATTATTGGGCTGGG + Intergenic
1122169217 14:99857935-99857957 TTCATTTGAATTCTTAGGCATGG - Intronic
1124023910 15:25947254-25947276 TTCCATTAAATTAGTGGGAAAGG + Intergenic
1124038030 15:26074514-26074536 TTCCTGTGAATTATTTAGAAAGG - Intergenic
1124574272 15:30894297-30894319 TTCCATTAAATTAGTGGGAAAGG + Intergenic
1125133170 15:36308700-36308722 TTCCTTTGTATTCTTGAGCATGG + Intergenic
1126078195 15:44933460-44933482 TTCCTTTGAATTAAGAGGAAAGG + Intergenic
1126272877 15:46843333-46843355 TTCCCCTGAATTTTTGGCCACGG + Intergenic
1127203970 15:56693214-56693236 TTCCTTTGAACTATTTAACAGGG - Exonic
1127650977 15:61006805-61006827 TCCCTTTGAATTATTGTCCTTGG + Intronic
1129143183 15:73621454-73621476 TAGCTTTGAGTTATAGGGCATGG - Intronic
1129804213 15:78440756-78440778 TTTTTCTGAAGTATTGGGCATGG + Intronic
1131537158 15:93246963-93246985 TTCTTCTAAATTACTGGGCAGGG - Intergenic
1131832560 15:96363069-96363091 GTCCCTGGAATTATTTGGCATGG + Intergenic
1134781212 16:16897220-16897242 TTCCTTTGCACAGTTGGGCAAGG - Intergenic
1135220149 16:20607389-20607411 TGCCTTTGAAGTATTGAGCCTGG - Intergenic
1135986258 16:27186784-27186806 TTACTTGGAATTATTCAGCATGG - Intergenic
1138134034 16:54506311-54506333 TTACTTTAAATAATTGGGAAGGG - Intergenic
1140972355 16:80025504-80025526 TCCCTTTATATTTTTGGGCATGG + Intergenic
1147847585 17:43415792-43415814 TTCCTTTAAATAGCTGGGCATGG - Intergenic
1147936777 17:44016066-44016088 TTCCTTTGAATCACTTGGCACGG + Intronic
1148433101 17:47658921-47658943 TTTTTTTAAATTATAGGGCATGG + Intronic
1151191949 17:72405143-72405165 TTTCTGTGATTTATGGGGCAGGG + Intergenic
1151649384 17:75456817-75456839 GTCCTTTGGATTCTTGGCCAAGG + Intronic
1156706797 18:39892503-39892525 TACCATTGAATTATTTGCCAAGG + Intergenic
1158826152 18:61222420-61222442 TTTCTTTGAATTATGGAGAAGGG - Intergenic
1164403163 19:27916960-27916982 TTCTTTTGAATTATTTTGCCTGG + Intergenic
926354229 2:12024957-12024979 TTTCTTTGAATTATTGGGCAGGG + Intergenic
926780062 2:16462236-16462258 TTCTTTTGGCTTCTTGGGCAGGG - Intergenic
927119609 2:19944656-19944678 TTCCTTTGAACTATTTCTCAGGG + Intronic
928175896 2:29034122-29034144 TACCTTTGAAGAAGTGGGCATGG - Intronic
929015477 2:37489461-37489483 GTCTTTGGAAATATTGGGCAGGG + Intergenic
930367934 2:50465560-50465582 TTCCTTTGGATTGTTTTGCAGGG - Exonic
931393864 2:61868579-61868601 TTCCTCTGAATTTCTGGGCTTGG - Exonic
931569861 2:63657149-63657171 TGGCTGTGAATTATTGGGGAGGG + Intronic
931642746 2:64396068-64396090 TACCTTTGGCTTCTTGGGCAGGG + Intergenic
935868047 2:107413238-107413260 TTTGTTTGAATTATTTGGCTTGG + Intergenic
936835871 2:116708639-116708661 TTAATTTGAATTATTTGGTATGG - Intergenic
937235141 2:120426893-120426915 GTCTTTTGAACTATTGGGCTGGG + Intergenic
938400907 2:130990833-130990855 TATCTTTGAATTATTGGTAAAGG + Intronic
939223965 2:139341144-139341166 TTCCATAGAATTATTGGAGAAGG - Intergenic
940093008 2:149943162-149943184 TTGTTTTGAATTATTTGGCTGGG - Intergenic
941109787 2:161406793-161406815 TCTCTTTTAATTATTGGGAATGG + Intronic
943432941 2:187826768-187826790 TTTCTTTGAATTATTGGGCAGGG + Intergenic
944397604 2:199286695-199286717 TTCCTGTGAATTTTTAGGCTAGG - Intronic
1169672365 20:8116648-8116670 TCCCTTTAACTTATTTGGCATGG + Intergenic
1169739262 20:8872619-8872641 TTGCTTTAAATTATTGGGACTGG + Intronic
1170061443 20:12263779-12263801 TTTTTTTAAATTAGTGGGCATGG - Intergenic
1171089777 20:22273314-22273336 TTTCTCTGAATTATTGGGCAGGG + Intergenic
1175512628 20:59542778-59542800 CCACTTTGAATTATTGGTCAGGG + Intergenic
1177135432 21:17301786-17301808 TTCCTTCGATATATAGGGCAAGG - Intergenic
1177384306 21:20389010-20389032 TTCCTTTGAGTTTTAGGGGAGGG - Intergenic
1177655256 21:24008736-24008758 TTGCTTATAATAATTGGGCATGG + Intergenic
1178346272 21:31831132-31831154 TTCCAGTGAATTCTTGGGGATGG + Intergenic
1182926148 22:34127039-34127061 TTCCTTAGACTTGGTGGGCAGGG + Intergenic
1184796626 22:46736985-46737007 TTCTTTTTAATTATTGGGGTGGG - Intronic
1184988009 22:48148524-48148546 TTCCTTTCAATGATTAGGAAGGG + Intergenic
952719682 3:36519384-36519406 TACCTGTAAATTATTGGGCTTGG - Intronic
953587148 3:44212916-44212938 TTCCTTTGTTTTAATGGGGATGG - Intergenic
954737758 3:52720792-52720814 TTGCTTTGAGTTATTGTGTAGGG - Intronic
956032072 3:65049159-65049181 TTTCTTTGAACTGTGGGGCAGGG + Intergenic
956869767 3:73405378-73405400 TTCCTTTGTTTTATGGGGGAAGG - Intronic
960913812 3:122677691-122677713 TTTCTTTGAATTATTGGGCAGGG - Intergenic
961154315 3:124666017-124666039 TTCCTTTGCAGTATGGGCCAAGG - Intronic
963613279 3:147500223-147500245 TTCCTTTAAATTCATGGGAACGG + Intronic
965338407 3:167456296-167456318 TTACTTTGACCTATTGGACATGG - Intronic
967610274 3:191497677-191497699 TTTTTTTGAACTTTTGGGCACGG + Intergenic
970329778 4:14968046-14968068 TTTCTTGGAATTTTTGGGCATGG - Intergenic
970916556 4:21342640-21342662 TTTCCTTGAATGATTGGGTAAGG - Intronic
971526814 4:27630221-27630243 TTCCTTTGATATATGGGACACGG - Intergenic
972401447 4:38707563-38707585 TTCCTTTTAATTATTGAATAAGG + Intergenic
973196363 4:47447331-47447353 TTCCTTTGAATTTTGGGGTTTGG - Intergenic
977348722 4:95852497-95852519 TTCCTTGGAATTTTTTTGCATGG - Intergenic
977869725 4:102077146-102077168 TTCCAAGGAATTAATGGGCATGG + Intergenic
979958181 4:126981536-126981558 TTCCTGTCAGTTAATGGGCATGG - Intergenic
980178674 4:129377631-129377653 TTCCTTTGTTTTCTTGGGAAGGG + Intergenic
981036815 4:140178555-140178577 TTCCTTCAAATTATTGTACAAGG + Intergenic
981262892 4:142743422-142743444 TCCCTGTGAATTCTTGGCCAAGG + Intronic
982361258 4:154521828-154521850 TTCCTTTAAAGGACTGGGCAGGG + Intergenic
982402829 4:154986870-154986892 TTCAATTGAATAATTTGGCAGGG - Intergenic
983809204 4:172037447-172037469 TTCCTGTGAAATAGTAGGCATGG - Intronic
984288180 4:177760553-177760575 TTCCTTTGAATTCCTAGGCGAGG + Intronic
984554323 4:181195858-181195880 TTTCTGGGAATTATTGAGCAAGG - Intergenic
987929307 5:24383604-24383626 TATCTCTGAATTATGGGGCAAGG - Intergenic
988418888 5:30981097-30981119 CTGCTTTGAAGTAATGGGCAGGG - Intergenic
992363206 5:76063914-76063936 ATCCTTTGAATTATTTAGAAAGG + Intergenic
993055772 5:82977467-82977489 TTTTTTTGAATTATTGGGCAGGG + Intergenic
994023719 5:95058170-95058192 TGTATTTGAATTATTGGGAAGGG - Intronic
995852608 5:116561728-116561750 GTCCTTTTAATTCTTGGGAACGG + Intronic
996354315 5:122579453-122579475 TCCCTTTGATTTCTTGGGCAAGG + Intergenic
996618086 5:125466053-125466075 TTCCTCTGGATCATTAGGCAAGG + Intergenic
998196288 5:140075435-140075457 TTCATTTCAAATATTTGGCAGGG - Intergenic
999037539 5:148369798-148369820 TCCCTCTGAAATAGTGGGCATGG - Intergenic
1000235052 5:159350302-159350324 TTCCTTTTTATTTGTGGGCAGGG - Intergenic
1001424691 5:171615575-171615597 TTCCTTTGAAATATTGGTGGTGG - Intergenic
1002603616 5:180369464-180369486 TTCCTCTGAACTTTTGGGGATGG - Intergenic
1003040967 6:2686973-2686995 TTCCCCTGATTTATTGTGCAAGG + Intronic
1005525916 6:26648735-26648757 TTCCTATGCTTTATTTGGCATGG - Intronic
1006955065 6:37862255-37862277 TTTCTTTGAATTCTTAGGCATGG - Intronic
1010783524 6:79972658-79972680 TTATTTTGAATTCTTTGGCAAGG - Intergenic
1011047392 6:83100096-83100118 TTCCTTAGAAATAATGGTCAGGG - Intronic
1012012909 6:93813933-93813955 TTTCTTAAAATTCTTGGGCATGG - Intergenic
1012023005 6:93949845-93949867 TTCCCTTGTATTATTGAGAAAGG - Intergenic
1012528248 6:100203086-100203108 TTCCTCTGAACCATTGGGTAGGG + Intergenic
1012725224 6:102802201-102802223 TTTTTTTAAATTAGTGGGCATGG - Intergenic
1016237747 6:141888315-141888337 TTCCTTAGAATTATTGGATTGGG - Intergenic
1016551836 6:145289829-145289851 TTTCTTTAACTTATTGGTCACGG - Intergenic
1017601449 6:156087126-156087148 TTCTTGTGAATTATTTTGCAGGG - Intergenic
1017966277 6:159269824-159269846 GGCCTTTGAATGATTGGACAAGG + Intronic
1020677025 7:11195334-11195356 TGGCTTTTAATTATTAGGCAAGG + Intergenic
1021257335 7:18409097-18409119 TTCCCTTGAATTTTTTTGCAAGG - Intronic
1021358187 7:19680224-19680246 TTTCTTTAGATTATTGGACATGG + Intergenic
1022202532 7:28131005-28131027 TTTCTGAGAATTATTGGGCATGG + Intronic
1025583962 7:62757724-62757746 TTCCTTTGAATTTTTATCCAGGG - Intergenic
1027346678 7:77267286-77267308 ATCCTTTGCAATATTGGGCCAGG - Intronic
1027977836 7:85181571-85181593 TTACTTGAAATTATTGTGCATGG - Intronic
1028019443 7:85751269-85751291 TTCCTTAGAATCATTGGACTGGG - Intergenic
1028588550 7:92473964-92473986 TTCCCTTGAAATAAGGGGCATGG + Intronic
1028601469 7:92605353-92605375 TTACTCTGACTTATTGGGAAAGG - Exonic
1028751507 7:94388672-94388694 TCCCTCTGAATTATGGGGCTTGG + Intergenic
1030337323 7:108341130-108341152 TTCCTTTGACATAAGGGGCATGG - Intronic
1031953980 7:127923254-127923276 TATCTTTCAATAATTGGGCAGGG - Intronic
1032280301 7:130494467-130494489 TGCCTTTGAAGTCCTGGGCATGG + Intronic
1032588314 7:133169067-133169089 TTTCTTTGAATTATTGGGCAGGG - Intergenic
1034856399 7:154552325-154552347 TTTGTTTGAATTTTAGGGCAAGG - Intronic
1035154673 7:156902610-156902632 TTCCTTAGAAATGTTGGGCCGGG - Intergenic
1036912089 8:12766005-12766027 TTCCGTTGCATTGTGGGGCAGGG + Intergenic
1036981303 8:13472861-13472883 TTCCTCTTTATTTTTGGGCAGGG + Intronic
1037281290 8:17245894-17245916 TTCCTGTTGATTCTTGGGCAGGG + Intronic
1037849930 8:22319087-22319109 TTCCTTTGATGTACTGGCCAAGG - Intronic
1038563318 8:28599065-28599087 TTCCTTTGAATTATTGGGCAGGG - Intergenic
1039366949 8:36938428-36938450 TTTGTTTGTAATATTGGGCAAGG + Intergenic
1040774393 8:51021716-51021738 CTATTTTGAATTATTGGTCAAGG - Intergenic
1041134485 8:54742720-54742742 TGCCTGTGAATTACTGGGAAAGG + Intergenic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1041647366 8:60267078-60267100 CTCCTTTGAGTTTTTGGGTAAGG - Intronic
1044146643 8:88724400-88724422 TTTTTTTGAATTCTTGGTCAGGG + Intergenic
1045413721 8:101945423-101945445 TTCCTTTGAATAACTTGTCACGG - Intronic
1046293337 8:112191014-112191036 TTCAGTTGAATTGTTTGGCATGG - Intergenic
1046601494 8:116322299-116322321 TTTCTCTGAATTATTGGATAAGG - Intergenic
1048322285 8:133409419-133409441 TTTCTTTGAATTATTGGGCAGGG + Intergenic
1050246802 9:3698636-3698658 TCCCTTTGAATCACTGGGCTGGG + Intergenic
1051448602 9:17169393-17169415 TTCCTTTGAATTGTTGAATATGG + Intronic
1055168175 9:73222227-73222249 TTCCTTGGTATTATTAGACATGG + Intergenic
1059061772 9:111040442-111040464 TACCTTTGATTTATGGGGAAAGG - Intergenic
1059908179 9:119011901-119011923 TTCCTAAGGATTATTAGGCAGGG - Intergenic
1186514824 X:10159076-10159098 TTGCTTTGCATTATTTTGCAAGG + Intronic
1188038660 X:25346613-25346635 TTCCTTTGATCATTTGGGCAGGG + Intergenic
1191803056 X:65102737-65102759 TTACGTTGAATTATCGGGGACGG - Intergenic
1192119132 X:68438478-68438500 TCCCTTTGAGATATTGAGCAAGG + Intergenic
1192543919 X:71997119-71997141 TTCCTTTGTCTTCTTGGGCTAGG + Intergenic
1193306740 X:79959766-79959788 TTCCTTTGACATAAGGGGCATGG - Intergenic
1193862427 X:86686519-86686541 TACCCTTCAATTACTGGGCATGG - Intronic
1193947092 X:87751612-87751634 TTATTTTGAATTATTTGCCAAGG - Intergenic
1194388474 X:93287392-93287414 TTTCTTTGAATTATTGGGCAGGG - Intergenic
1196110853 X:111945758-111945780 TTCCTTGGCTTTACTGGGCAAGG - Intronic
1196129506 X:112139610-112139632 TTAATTTGAATTATTCGGTAAGG + Intergenic
1196137759 X:112228320-112228342 TTCCTTTGAACTTGTGGGTATGG - Intergenic
1196369559 X:114961595-114961617 TTCCTCTGAATTTCTGGGCTTGG - Intergenic
1196835778 X:119812447-119812469 TGCCCTAGAATTATGGGGCAGGG - Intergenic
1198006169 X:132496144-132496166 TTCATTTGAATTATTGGTTTAGG - Intergenic
1202581841 Y:26389936-26389958 TTCTTTTGTATTAATGAGCATGG - Intergenic