ID: 909952043

View in Genome Browser
Species Human (GRCh38)
Location 1:81732090-81732112
Sequence CACTTCCCTTTGAAAATATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909952043_909952044 11 Left 909952043 1:81732090-81732112 CCATATATTTTCAAAGGGAAGTG 0: 1
1: 0
2: 2
3: 22
4: 253
Right 909952044 1:81732124-81732146 CATATTCATTATCTTGACCTTGG 0: 1
1: 0
2: 4
3: 37
4: 393
909952043_909952045 17 Left 909952043 1:81732090-81732112 CCATATATTTTCAAAGGGAAGTG 0: 1
1: 0
2: 2
3: 22
4: 253
Right 909952045 1:81732130-81732152 CATTATCTTGACCTTGGAGCAGG 0: 1
1: 0
2: 2
3: 11
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909952043 Original CRISPR CACTTCCCTTTGAAAATATA TGG (reversed) Intronic
901688564 1:10958251-10958273 CACATCCCTTTGAATATTTGGGG - Intronic
901954810 1:12776484-12776506 CCCCTCCATTTTAAAATATAAGG + Intronic
904714967 1:32460776-32460798 CATTTCCCTTTGGGAAGATAGGG + Intergenic
908548222 1:65183142-65183164 CTGTTCCCTCTGACAATATAGGG - Intronic
909682060 1:78302852-78302874 CACTTCTCTTTGAGAAAGTAAGG - Intergenic
909906264 1:81199486-81199508 GCCTTCCCTTTCAAAATATTTGG - Intergenic
909946802 1:81672816-81672838 AACTTCCCCTTGATAATTTATGG + Intronic
909952043 1:81732090-81732112 CACTTCCCTTTGAAAATATATGG - Intronic
915455090 1:156035318-156035340 CACTGGCCTTTGTAAATAAATGG - Exonic
917180904 1:172296640-172296662 CACCTCCCTTTCCAATTATAAGG + Intronic
918074253 1:181158510-181158532 CACTTCACAGTGAAAAAATAAGG + Intergenic
918513845 1:185340595-185340617 CATTTCCCTTTAAAAATAGCTGG + Intergenic
919260427 1:195186192-195186214 CACTCCCTTTTACAAATATAAGG - Intergenic
920658916 1:207898635-207898657 CATTTCCCTTTGGGAATATTTGG - Intronic
921000833 1:211041100-211041122 GACTTCCCTTTCAAAAAATCTGG - Intronic
922149640 1:222987570-222987592 TTCTTCCCTTTGAAAACATTTGG - Intronic
922994497 1:229944943-229944965 CTATTCTCTTTGAAAATATGAGG - Intergenic
1063293020 10:4770857-4770879 CACATCCCTTTGAAACCATATGG + Intergenic
1063853067 10:10215005-10215027 CACGTGGCTTTGAAAAGATAAGG - Intergenic
1065269115 10:24008666-24008688 GACTTCCCTTTGTAAGCATATGG + Intronic
1065275282 10:24079456-24079478 CATTTCCCTTAGAAAATAAATGG + Intronic
1065855306 10:29825422-29825444 TCCTTTCCTTTGAAAATATGAGG - Intergenic
1066218381 10:33310984-33311006 CAGTCCCCTTTGAAGAGATAAGG + Intronic
1066240719 10:33532093-33532115 CAATTACCTTTGAAAACATGTGG - Intergenic
1069032740 10:63615273-63615295 CTCTTCATTTTGAAAAAATAAGG + Intronic
1069899345 10:71698223-71698245 AACTTCCTTTTCAAAATATTTGG - Intronic
1071921284 10:90353798-90353820 TACTTGTCTTTGATAATATAAGG + Intergenic
1072436922 10:95422407-95422429 CACTGACCTTTGAAAACACAAGG + Intronic
1072567199 10:96626701-96626723 TACTTGCCTTTAAAAATGTATGG + Exonic
1074458168 10:113613415-113613437 TACTTCCCTATGAGAAAATAAGG + Intronic
1076185895 10:128448473-128448495 CATTTCTCTTTAAAAATATTAGG - Intergenic
1078722375 11:13896925-13896947 TCCTTCCCTTTGAATATCTAGGG - Intergenic
1079733697 11:23968597-23968619 CACAACCTCTTGAAAATATATGG - Intergenic
1079934603 11:26600997-26601019 CAATTTCCTCTGAAAATAGAAGG + Intronic
1080492190 11:32777858-32777880 GACTTCCCATAGAAAATAGAAGG - Intronic
1080711310 11:34750287-34750309 CATCTCTCTTTGAAAATAAATGG - Intergenic
1081276930 11:41161755-41161777 CACATCCCGATGAAAATAAAAGG - Intronic
1085307148 11:75493016-75493038 CACTGCACCTTGCAAATATAGGG + Intronic
1085413467 11:76305595-76305617 CACTTGGCTTGGAAAATAAAAGG - Intergenic
1086194165 11:84116994-84117016 CACTTTACTTTGTAAATATATGG + Intronic
1087478499 11:98668466-98668488 AATTTTCCTTTAAAAATATATGG + Intergenic
1087892436 11:103550643-103550665 CACTGTCCTATGAAAATATCCGG + Intergenic
1088314241 11:108490963-108490985 CACTTACCTTTCAAAATATAGGG + Exonic
1093502972 12:19833446-19833468 CACTCTCCTTTGTAAAAATAAGG - Intergenic
1095124598 12:38461949-38461971 CACTTACATTTGAGAATATGTGG - Intergenic
1095382230 12:41609153-41609175 GACTTCACTTTGAAACTGTATGG + Intergenic
1096949277 12:55448338-55448360 CTGTTCATTTTGAAAATATAAGG + Intergenic
1098099419 12:66998314-66998336 AACTTCCCTATGAAATTATTTGG - Intergenic
1098704419 12:73669882-73669904 CACTTTCATTTCAAAATATATGG - Intergenic
1099857610 12:88186831-88186853 CTCTGCTCTTTGAAAACATAGGG + Intronic
1100311285 12:93397132-93397154 CTTTCCCCTTAGAAAATATAAGG + Intronic
1103543536 12:121683202-121683224 CATTTTCCTTTGGAAAAATAAGG - Intergenic
1104780625 12:131417704-131417726 CACAGCCCTTTGGAAATGTATGG + Intergenic
1105611633 13:21974310-21974332 CACCTCCCTTTAAAAATAGGGGG - Intergenic
1106468570 13:30034599-30034621 CTTTTCCCTTTGATAACATAGGG + Intergenic
1106787602 13:33122661-33122683 CATTTCCTTTTGAAGATAAAAGG + Intronic
1107317166 13:39145526-39145548 AGCTTCCCTTTGAAAAGATGTGG - Intergenic
1107740970 13:43450272-43450294 CACTTCACCTTGCAAATTTAAGG - Intronic
1108725104 13:53172199-53172221 CATTTCCCCTTCAAAATATTAGG - Intergenic
1109092064 13:58060500-58060522 CAATTCCCTTCGAAAATATCAGG - Intergenic
1109098889 13:58153212-58153234 CATTTACCTTTCAAAATCTAGGG - Intergenic
1109979566 13:69889300-69889322 CCATTCCCTTTGAAATTCTAAGG - Intronic
1109982482 13:69926598-69926620 CAATTTCATATGAAAATATAGGG + Intronic
1110848318 13:80215303-80215325 CAGTTCACTTACAAAATATAGGG - Intergenic
1112086440 13:96036974-96036996 CACTTGCCTTACAAAATATATGG + Intronic
1112771192 13:102796797-102796819 AAATTACCTTTTAAAATATATGG + Exonic
1112864702 13:103879905-103879927 CAATGCCATATGAAAATATATGG - Intergenic
1113308126 13:109100591-109100613 CATTTCCCTTATAAAAGATAAGG + Intronic
1115443387 14:33461965-33461987 CCTTTCCCTTAGAAAATATAAGG - Intronic
1115483414 14:33885183-33885205 ATCTTCCCTTTGCAAAGATATGG - Intergenic
1116435599 14:44892353-44892375 CACTTCACTTTGAAAAAACTTGG - Intergenic
1117199719 14:53376383-53376405 CACTTCCCTTGGCAGATTTATGG - Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118051276 14:62031132-62031154 AAAGTCTCTTTGAAAATATATGG + Intronic
1118685742 14:68289411-68289433 CATTTCTCTTTTATAATATAGGG - Intronic
1120208061 14:81607582-81607604 CAACTTCCCTTGAAAATATATGG + Intergenic
1121882977 14:97516809-97516831 CATTTCTCTTGGAAAATATCAGG + Intergenic
1124511144 15:30326949-30326971 CGGTTCCCTTTCACAATATATGG - Intergenic
1124695346 15:31859798-31859820 CACTTCCTATTGAAACGATAGGG - Intronic
1124731770 15:32203816-32203838 CGGTTCCCTTTCACAATATATGG + Intergenic
1125065831 15:35485403-35485425 CACTTTCCTTTGCCAAGATAGGG + Intronic
1125418706 15:39480365-39480387 CTATTACCTTTGAAAATATTTGG - Intergenic
1127504818 15:59588182-59588204 TACTTTCCTTGGAAAATAGATGG + Intergenic
1127518145 15:59716110-59716132 CATTTAACTTTGAAACTATAAGG - Intergenic
1128691794 15:69730000-69730022 AACTTCGCTTTGAAATTATTTGG + Intergenic
1129087165 15:73106911-73106933 AACTTCCCTTACAAAATACAAGG - Intronic
1133459651 16:5976510-5976532 CACTTCCCTTAGGAATTCTAAGG + Intergenic
1134146563 16:11769404-11769426 CCTTTCCTTTTGAAAATATGGGG + Intronic
1135233701 16:20735012-20735034 CACTTGGCCTTGAAAATAAAGGG - Exonic
1136270610 16:29146257-29146279 CCCTTCTCTTTGAAGAAATAAGG + Intergenic
1137765621 16:50975529-50975551 CTCTTCCCTTTGCAAGTTTAAGG - Intergenic
1139532636 16:67550194-67550216 CACTTCCTTTTGAACATCTGGGG + Intergenic
1140307391 16:73816335-73816357 CACTTTCCTATGAACATACATGG - Intergenic
1142074198 16:88108068-88108090 CCCTTCTCTTTGAAGAAATAAGG + Intronic
1144256081 17:13470084-13470106 CACTGCCCTTTGAAATGCTAAGG + Intergenic
1144346297 17:14352992-14353014 CTCTTCTCTTTTCAAATATATGG - Intergenic
1150332692 17:64307188-64307210 CACGTGCCTTTATAAATATATGG - Intergenic
1150365495 17:64579594-64579616 CATTTCTCTTTGAGATTATAAGG - Intronic
1153332524 18:3888525-3888547 CATTTCCTTTTCAAAAGATATGG + Intronic
1153673813 18:7437887-7437909 TACCTCCCTTGCAAAATATAAGG - Intergenic
1155884017 18:31185691-31185713 CACTTCCCTTAGTAAATAGAAGG - Intergenic
1156024759 18:32639306-32639328 CATTTCCATTTAAAAATACATGG + Intergenic
1157882909 18:51338867-51338889 CAACTCCCTGTTAAAATATATGG - Intergenic
1159391194 18:67794377-67794399 AACTTCACTTTTAAAATACAAGG + Intergenic
1159456735 18:68668985-68669007 CACTTACAATTGAAAACATATGG - Intergenic
1159972147 18:74667775-74667797 CGCTACCCTTTGTAACTATATGG - Intronic
1161842735 19:6692804-6692826 CAATTCCCTTTGCAAAGATTGGG - Intronic
1166012762 19:39955491-39955513 CATTTCTCTTTGAAAATATAGGG + Intergenic
1167058335 19:47127470-47127492 CATTTTCCTTTAATAATATAAGG + Intronic
925361224 2:3281796-3281818 CAGTTACATTTGAAAAGATATGG - Intronic
925697175 2:6593407-6593429 CACTTCCCTGTGGAACTCTATGG - Intergenic
926167933 2:10533117-10533139 CCCTTCCCTTTGAAATCAGAGGG + Intergenic
926775790 2:16421643-16421665 CACTTTTCTTTGTAAATAGAAGG + Intergenic
926861996 2:17319744-17319766 CACTTCCCTTAGGAAAGATAGGG - Intergenic
927009848 2:18891936-18891958 CCCCTCCCTTTGAAAATTTAAGG + Intergenic
927229339 2:20804829-20804851 CACTGTCCATTAAAAATATATGG + Intronic
930607729 2:53509626-53509648 CGCTTCTCATTGAAAATACAAGG + Intergenic
933308753 2:80634625-80634647 CGCTTCCATTTGAGAATAAACGG + Intronic
933309478 2:80642592-80642614 CACTTTCCTTTGAAAGAATGTGG + Intronic
933364375 2:81330781-81330803 AAATTCCCTTTTACAATATAAGG + Intergenic
933611886 2:84444847-84444869 CATTTGCTTTTGAAAAAATATGG + Intronic
933654605 2:84877321-84877343 CATTTCACTGTTAAAATATATGG + Intronic
933905740 2:86890836-86890858 CAAATCCCTTTGAGAATCTAAGG - Intergenic
934632971 2:95950285-95950307 CACTGCCATTTCAAAATATTTGG + Intronic
934800532 2:97152965-97152987 CACTGCCATTTCAAAATATTTGG - Intronic
935129931 2:100254190-100254212 CTCTTCACTTTTAAAAAATATGG + Intergenic
935766580 2:106373998-106374020 CAAATCCCTTTGAGAATCTAAGG - Intergenic
935975243 2:108571954-108571976 CCCATCCTTTTTAAAATATAAGG - Intronic
936366422 2:111860818-111860840 CAAATCCCTTTGAGAATCTAAGG + Intronic
936630981 2:114202444-114202466 CGCTGCACTTTAAAAATATAAGG + Intergenic
939500423 2:142976561-142976583 CACTTACATTTTAAAATATTTGG + Intronic
940683114 2:156810912-156810934 TCCTTCCTTTTGAAAATGTATGG + Intergenic
941492241 2:166156837-166156859 CAGTTCCCTTTAAAAACACATGG + Intergenic
941904184 2:170705397-170705419 CATTTACCTTGGAAAATTTAAGG - Intergenic
945136838 2:206638673-206638695 CACTTGCCCTTGAAAACAGAGGG - Intergenic
945598899 2:211833432-211833454 GAGTTCACTTTGTAAATATAAGG + Intronic
945599363 2:211839652-211839674 CAAATCTCTTTGTAAATATATGG + Intronic
947064945 2:226213652-226213674 TACTTACGTTTGAAAATATTTGG - Intergenic
1169816612 20:9663638-9663660 CCCTTCCCTTTGGAAATGTAAGG + Intronic
1169882413 20:10361505-10361527 CACCTCCCTATGAAAGTGTAAGG - Intergenic
1171311068 20:24144947-24144969 CATATCCCTTTGGAAATTTAAGG + Intergenic
1171327152 20:24304828-24304850 CAATGCTCATTGAAAATATAGGG - Intergenic
1173056612 20:39619982-39620004 TACTTATCTTTGAAAACATATGG - Intergenic
1173935121 20:46854679-46854701 TTCTTACCTTTGAAAATATTCGG - Intergenic
1174283344 20:49454962-49454984 AACTGCCATTTGAAAATAGAGGG + Intronic
1174986857 20:55464104-55464126 CATTTCACTAAGAAAATATAAGG - Intergenic
1175462845 20:59166131-59166153 AATTTTCCTTTGAATATATAAGG + Intergenic
1177220549 21:18186630-18186652 CACTTCACTTTAAAACTACAAGG - Intronic
1177422843 21:20883871-20883893 TATTTCCAGTTGAAAATATAGGG - Intergenic
1177564524 21:22801551-22801573 TAATCCCCTTTGAAAATAAAGGG - Intergenic
1180030938 21:45207110-45207132 CACTGTCCTATGAAAATAAAAGG + Intronic
1183052148 22:35271842-35271864 CACTTGGCTTTGAAAAGATATGG - Intronic
949450610 3:4180919-4180941 CACTTCTCTTTGAGAACACAAGG + Intronic
951256816 3:20459466-20459488 CACTTCCGTTTGCCAATACAAGG + Intergenic
953187690 3:40653779-40653801 CTCCTCCCTTTGTAAACATAGGG + Intergenic
956080829 3:65554183-65554205 CACTTCCCTTTGAGAAGGCATGG + Intronic
959108216 3:102090745-102090767 TGCTTCCCTTTGTAATTATAAGG + Intergenic
959293710 3:104507789-104507811 CATTTCTCTTTGAAGTTATATGG - Intergenic
959537074 3:107498707-107498729 CACCTCGCTTTGAAATAATAGGG - Intergenic
959741885 3:109730031-109730053 CACTTCCATTTAAAAATTCAGGG - Intergenic
960723099 3:120643608-120643630 AACATACCTTGGAAAATATAAGG + Intronic
960778186 3:121286180-121286202 CCCTACCCTTTGAAAAGAAAGGG - Intronic
963712666 3:148765221-148765243 CATCTCCCTTTGAAAATGAATGG - Intergenic
963732001 3:148984201-148984223 CACTGGCCTTTGTAAATAAATGG - Intergenic
966268653 3:178078472-178078494 CACTTGATTGTGAAAATATATGG + Intergenic
966684801 3:182682545-182682567 CACTTCTCTTTAATAATAAATGG + Intergenic
966776608 3:183548165-183548187 CAGTGCGCTCTGAAAATATATGG + Intronic
967879572 3:194291666-194291688 CACTTCCCACAGAAAATATATGG + Intergenic
970119592 4:12738502-12738524 CACTTCCATATGAATAAATATGG + Intergenic
970152007 4:13099629-13099651 CATTTACCTTTGAAAAATTAAGG - Intergenic
970790454 4:19852252-19852274 CACCTGCATTTGGAAATATAAGG + Intergenic
971660862 4:29413932-29413954 AACTTCCCTTCAAAATTATATGG + Intergenic
971722176 4:30259259-30259281 CACTACCCTTTAAAAATACGAGG + Intergenic
972303167 4:37805461-37805483 AAATTCCCTTTGAAACAATAAGG - Intergenic
972799233 4:42455931-42455953 CAATTCCCTTTTAAAATATCAGG + Intronic
975259728 4:72283658-72283680 CACTTCCATTTGACAGAATATGG + Exonic
975421145 4:74166470-74166492 CCCTTCCTTTTGAAGAGATAAGG + Intronic
976211268 4:82673132-82673154 CACTCCCTTTTGACATTATATGG + Intronic
976732334 4:88276491-88276513 CATTTCACTTTCAAAATTTAAGG + Intronic
977096885 4:92757478-92757500 AACTTCCCTTTGATAAGACAAGG - Intronic
977316587 4:95456814-95456836 CAGTTCCCTATGCAAATATGAGG + Intronic
977579678 4:98711435-98711457 CTCTTTCCTTTGGAAATAGAAGG - Intergenic
977847700 4:101785565-101785587 CACTACCCTATGAAATTATGAGG + Intronic
979231843 4:118355236-118355258 TACTTTTCTTAGAAAATATAAGG + Intergenic
979314741 4:119248785-119248807 CACTTCCCTCAGATAACATAAGG + Exonic
980140041 4:128904245-128904267 CACTTCCCAGTGATACTATAAGG - Intronic
980695300 4:136347618-136347640 TACTCACCTTAGAAAATATAAGG + Intergenic
982264801 4:153528452-153528474 CATTCCCCTTTGGAAATTTAGGG + Intronic
983012881 4:162570234-162570256 CTCTTCCTTTTAAAAATAAAAGG - Intergenic
983639064 4:169927543-169927565 CACTTCCTTTTGAACCTAGAAGG - Intergenic
983847494 4:172538080-172538102 CATTTCTCCTTGAAAGTATATGG - Intronic
984445477 4:179830729-179830751 CACTTCCATTTGATGAGATAGGG - Intergenic
984944304 4:184959323-184959345 CACTTCCATCTGAAAAGAGAAGG - Intergenic
985377614 4:189358059-189358081 CTCTTTGCTTAGAAAATATAAGG + Intergenic
986526047 5:8677021-8677043 CACTTTCCTTTGAAACTGTGTGG - Intergenic
986793477 5:11186520-11186542 CACTATCCAATGAAAATATATGG - Intronic
986943764 5:12989673-12989695 CATTTGCCTTTTCAAATATAAGG + Intergenic
987270608 5:16304626-16304648 CACTTCTCTTTTTAAAAATATGG + Intergenic
989785745 5:45326945-45326967 CACTTCCATTTGATTATAAAGGG + Intronic
990353957 5:54946676-54946698 CAATTCACTTTGCAAATAGAAGG - Intergenic
991521002 5:67496153-67496175 CTCTTCCCTGGGAAAAAATAAGG - Intergenic
992807826 5:80354819-80354841 CCCTTCCCTTAGATAAAATATGG - Intergenic
994062029 5:95488933-95488955 AACTTTCCATTGAAAATATATGG + Intronic
996205229 5:120726162-120726184 CGCTTTACATTGAAAATATAAGG + Intergenic
997073671 5:130646351-130646373 TACTTCCCTTCAAAAAGATAGGG - Intergenic
1003979773 6:11378709-11378731 CACTTTCCTTGGAAAGTAGAGGG + Intronic
1005150708 6:22746604-22746626 CACTTCTATGTGAAAACATAAGG - Intergenic
1009447678 6:63762764-63762786 CTCTTTCCTTTGACAATTTAGGG - Intronic
1009749768 6:67868551-67868573 CACTTTTCTTTAAAAATATACGG + Intergenic
1011774158 6:90709321-90709343 CACTTCACTTTCAAAAGTTAAGG - Intergenic
1013879184 6:114873946-114873968 AACTACCTTTTTAAAATATAAGG + Intergenic
1016294675 6:142562276-142562298 CTCTTCCCTGTGAGAATAGAGGG - Intergenic
1016298532 6:142602579-142602601 CACAACACTTTGCAAATATAGGG - Intergenic
1016437737 6:144055126-144055148 CATTTCTTTTTCAAAATATATGG - Intronic
1016599581 6:145842678-145842700 CACTTCCTTATGAAATTAAAAGG - Intergenic
1017483131 6:154877866-154877888 TATTTCCCTTTTAAATTATAAGG - Intronic
1020286924 7:6689523-6689545 CACTTCCTTTTGAGGATAAATGG + Exonic
1020495609 7:8849185-8849207 CACTTCCCACTGAAAATCAAGGG - Intergenic
1020967836 7:14894772-14894794 CACTTCACTTTCAGAATATGTGG + Intronic
1021152649 7:17169823-17169845 CCCTTCTCTTTGAAGACATAGGG + Intergenic
1021277615 7:18673718-18673740 CACATCAATTTGAAAATAGATGG + Intronic
1022095199 7:27136254-27136276 CACTGCCATTTGAAATTAGAGGG + Intronic
1023532150 7:41169253-41169275 CCCTTCCCTTTAGTAATATATGG - Intergenic
1027869091 7:83683600-83683622 AATTTCCATTTGAAATTATATGG + Intergenic
1028030648 7:85907803-85907825 CTCTTCCCTTCCAAAATATGAGG + Intergenic
1028109743 7:86925601-86925623 CACTTGGCTTTGAATATAAATGG - Exonic
1028641375 7:93045361-93045383 CACTGCCTTCTGTAAATATAAGG - Intergenic
1028777719 7:94698889-94698911 CATTTTCCTTTTAAAATATCTGG + Intergenic
1030192299 7:106821850-106821872 CACTTCCATTTGATGATAGAGGG - Intergenic
1030621610 7:111796648-111796670 CACTTACCTTTAAAAAAAAATGG - Intronic
1030928590 7:115491674-115491696 CACTACTCTTATAAAATATATGG - Intergenic
1030945889 7:115719767-115719789 CACTTCCCTATGAACATCAATGG + Intergenic
1031152836 7:118074331-118074353 CACATCCATTTGAATATAGATGG - Intergenic
1031267815 7:119604115-119604137 CACTTACCTTTCACCATATATGG + Intergenic
1032262009 7:130345970-130345992 CACTTCCCGTCTAAAATATCTGG - Intronic
1032286970 7:130546082-130546104 CACTTCCCTCTGAAATTAAGTGG + Intronic
1032354683 7:131199549-131199571 CACTTCCCTTGGAGAAGAAAGGG + Intronic
1032916155 7:136492437-136492459 GGCTTCCCTATCAAAATATAAGG - Intergenic
1033235471 7:139634636-139634658 CACATCCCTTAGAAAAAAGAAGG + Intronic
1038978286 8:32725779-32725801 CAATTGCCTTTAAAAATATCAGG - Intronic
1039144353 8:34429502-34429524 AACTTCACTTTAAACATATAGGG + Intergenic
1040897747 8:52386665-52386687 CTCTCCCCTTTTAAAATAAAAGG - Intronic
1043259299 8:78177430-78177452 CAGGTCCCTTTCAAAATCTAAGG - Intergenic
1043394462 8:79823254-79823276 CACTTCCATTTTAAGAAATAAGG + Intergenic
1043690600 8:83146234-83146256 CTCTTCCCATTGAAAATACATGG - Intergenic
1044768172 8:95599210-95599232 GGCTTCCCTTTGTAAAAATAAGG - Intergenic
1045176373 8:99729323-99729345 CTTTTCCCTTTGCAAATATCTGG + Intronic
1045890438 8:107150197-107150219 CACTTGTCTTTGAGAATTTAAGG + Intergenic
1046110861 8:109722363-109722385 AACTTCATTTTGATAATATAAGG - Intergenic
1046297482 8:112240346-112240368 CATTTCCCTTGGAAAATTTGGGG + Intronic
1046444194 8:114294782-114294804 AACTTCTCTTTGAAGATTTAGGG - Intergenic
1046723537 8:117650187-117650209 CACTTCCCTTTAAAATTAGGAGG - Intergenic
1047139022 8:122114798-122114820 CACCTTTCTTTGTAAATATAAGG + Intergenic
1048165015 8:132054570-132054592 CACTTACCCTTGAAAAAATTGGG + Intronic
1050949401 9:11568572-11568594 CACTTCTATGTGAAAATCTAAGG - Intergenic
1051710781 9:19928273-19928295 CAATTCCCTTTTAAAAGATAAGG - Intergenic
1052440182 9:28486497-28486519 TACTTTCTTTGGAAAATATAAGG - Intronic
1054715863 9:68557319-68557341 CACTTCCCTATTTAAATATAAGG + Intergenic
1054731024 9:68703348-68703370 CACTTCTCTCTGAAAACCTAAGG + Intergenic
1054968032 9:71052226-71052248 CATTTACTTTGGAAAATATATGG - Intronic
1058096441 9:100865694-100865716 CAATTCCCTTTGGAAACATAGGG + Intergenic
1058218325 9:102262696-102262718 CATTTCCTTGTGAATATATAAGG - Intergenic
1060213898 9:121726844-121726866 CCCTTCCCCTTGAAGATAAAGGG - Intronic
1185847634 X:3453825-3453847 CACTTGGCTTTAAAAATATCTGG - Intergenic
1186790543 X:12993463-12993485 CACTTCTCCTTAAAAATAGAAGG + Intergenic
1187648996 X:21379369-21379391 CACTTCCTTTTGAAAACTTAGGG + Intronic
1187808664 X:23150539-23150561 CCCTTTCCTTTTTAAATATAGGG + Intergenic
1191054347 X:56227057-56227079 CACTTCCCTCAGAAAGTAAAAGG - Intergenic
1191200499 X:57776117-57776139 CACTCCCATTGGAAAATGTAAGG + Intergenic
1194619217 X:96148099-96148121 TTATTCCCTTTGAAAAAATAGGG - Intergenic
1194820583 X:98501752-98501774 CATTTGCCTTTGAAAATGTATGG + Intergenic
1195091003 X:101458992-101459014 TACTTCCCTTCTACAATATAGGG - Intronic
1195842505 X:109189718-109189740 CATTTCCCTTTGAAATTTGAAGG - Intergenic
1196162203 X:112498480-112498502 TAGTTCCCTCTCAAAATATAAGG - Intergenic
1197782797 X:130173674-130173696 CACTTCCCTTCCAAAATGCAAGG - Intronic
1198988897 X:142488256-142488278 CTCTTCCATTTGAGATTATATGG - Intergenic
1200329063 X:155275382-155275404 CATTTCCCTGTGAAACTATCTGG + Intergenic
1200795518 Y:7337878-7337900 CACTTACCTTTAAAAAGATGAGG - Intergenic