ID: 909956361

View in Genome Browser
Species Human (GRCh38)
Location 1:81783901-81783923
Sequence GAATTAATACAGATAGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909956361_909956364 11 Left 909956361 1:81783901-81783923 CCAGGTACTATCTGTATTAATTC No data
Right 909956364 1:81783935-81783957 ACAACAACATTATAAGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909956361 Original CRISPR GAATTAATACAGATAGTACC TGG (reversed) Intronic
No off target data available for this crispr