ID: 909958349

View in Genome Browser
Species Human (GRCh38)
Location 1:81803440-81803462
Sequence CAGAGTGAACAGAGGATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 306}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909958349_909958356 15 Left 909958349 1:81803440-81803462 CCTCCAATCCTCTGTTCACTCTG 0: 1
1: 0
2: 0
3: 35
4: 306
Right 909958356 1:81803478-81803500 GTTGGGAGGGACAAGTCCTGCGG No data
909958349_909958352 -3 Left 909958349 1:81803440-81803462 CCTCCAATCCTCTGTTCACTCTG 0: 1
1: 0
2: 0
3: 35
4: 306
Right 909958352 1:81803460-81803482 CTGTGCTCTCAAAGAATAGTTGG No data
909958349_909958354 1 Left 909958349 1:81803440-81803462 CCTCCAATCCTCTGTTCACTCTG 0: 1
1: 0
2: 0
3: 35
4: 306
Right 909958354 1:81803464-81803486 GCTCTCAAAGAATAGTTGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 134
909958349_909958355 2 Left 909958349 1:81803440-81803462 CCTCCAATCCTCTGTTCACTCTG 0: 1
1: 0
2: 0
3: 35
4: 306
Right 909958355 1:81803465-81803487 CTCTCAAAGAATAGTTGGGAGGG 0: 1
1: 0
2: 1
3: 14
4: 149
909958349_909958353 -2 Left 909958349 1:81803440-81803462 CCTCCAATCCTCTGTTCACTCTG 0: 1
1: 0
2: 0
3: 35
4: 306
Right 909958353 1:81803461-81803483 TGTGCTCTCAAAGAATAGTTGGG 0: 1
1: 0
2: 1
3: 7
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909958349 Original CRISPR CAGAGTGAACAGAGGATTGG AGG (reversed) Intronic
900465395 1:2822766-2822788 TAGAGTGGACAGAGGCTGGGAGG + Intergenic
901117257 1:6857099-6857121 CTGAGTGGTCAGGGGATTGGAGG + Intronic
901278873 1:8015767-8015789 CAAAGCTAACAGAGGATTTGGGG + Intronic
901285680 1:8076822-8076844 CACAGGGCACAAAGGATTGGTGG - Intergenic
901400676 1:9013430-9013452 CAGAGTGAACTGAGTGCTGGTGG - Intronic
901734511 1:11303998-11304020 AAGAGTGGACAGAGCATTTGAGG + Intergenic
902421871 1:16287131-16287153 CAGAGTGAACAAAGGAGAGGAGG - Intronic
903302287 1:22387903-22387925 CAGCCTAAACAGAGGCTTGGAGG + Intergenic
903788976 1:25879898-25879920 CAGACTGGACTGAGGATGGGGGG - Intergenic
903883547 1:26528780-26528802 CAGGATGAACCGAGGCTTGGTGG - Intergenic
904584390 1:31571852-31571874 TAGAGAGAACAGATGATTGCAGG - Intergenic
904893727 1:33798668-33798690 CAGTGTGAAGGGAGGATTGGAGG + Intronic
905916572 1:41688740-41688762 CAGAATGATCAGAGGAGAGGTGG - Intronic
906154195 1:43604589-43604611 CAGAGTGATCAGAGGGTCAGTGG - Intronic
907323497 1:53620357-53620379 CAGGGTGAACAGAAAATGGGCGG + Intronic
907841840 1:58165720-58165742 CAGAGTGGGCAGAGGTTTTGGGG + Intronic
908044097 1:60149501-60149523 CAGTGTGAACTGGGGACTGGAGG + Intergenic
909462003 1:75927511-75927533 AAGGGTGAACAGAGGTTGGGAGG + Intronic
909958349 1:81803440-81803462 CAGAGTGAACAGAGGATTGGAGG - Intronic
912720554 1:112016403-112016425 CAAAGTGAGCAGAGGGTTGGGGG - Intergenic
912861775 1:113219841-113219863 CAGAGTGACCACAGGCCTGGTGG + Intergenic
915018959 1:152761623-152761645 AAGAGTGAGCAGAGGCTTGGAGG - Exonic
915278290 1:154804888-154804910 CAGTGTGTGCAGAGGGTTGGAGG - Intronic
915919296 1:159962185-159962207 CAAGGGGAACAGAGGATGGGAGG + Intergenic
916076034 1:161200488-161200510 CAGAGTGAATAGGGGAATAGAGG - Intronic
916424890 1:164670808-164670830 GACAGTGAACAAAGCATTGGGGG + Intronic
916866352 1:168863627-168863649 AATAGAGAATAGAGGATTGGCGG - Intergenic
916921674 1:169475631-169475653 GAGAGTCAACAGAGGGTTGATGG - Intronic
917397304 1:174607563-174607585 CAGAGAGCACAAAGGAGTGGTGG - Intronic
917683402 1:177391490-177391512 CAGAGCGGACAGAGGATTGCAGG + Intergenic
917813009 1:178678632-178678654 CACAGTGAACTGAAAATTGGAGG + Intergenic
918078828 1:181190386-181190408 CAGAGTGATCTGGGGAGTGGAGG + Intergenic
919204340 1:194401676-194401698 CAGAGTGAGGAGAGGAAAGGAGG + Intergenic
919511628 1:198472434-198472456 CAGAGGGAACTGATGTTTGGTGG + Intergenic
920071633 1:203306585-203306607 CAGAGGGAACACAGGGTGGGAGG + Intronic
923010641 1:230084877-230084899 CAGGGTGAACATGGGATTAGGGG + Intronic
923124451 1:231023043-231023065 CAGTGGGAACTGAGGACTGGAGG - Intronic
923803145 1:237229853-237229875 CAGAGTGGACGCAGGGTTGGTGG - Intronic
1062860061 10:803797-803819 GGGAGTGAACACAGGGTTGGTGG + Intergenic
1063300555 10:4845760-4845782 CAGACCTAACAGAGGAATGGGGG - Intronic
1063377845 10:5564700-5564722 CAGAGTGAGCAGAGGATGTTTGG - Intergenic
1065712281 10:28530187-28530209 GAGAGAGAACAGAGGAGTGCGGG + Intergenic
1065797615 10:29321776-29321798 CAGAGTGAGCAGGGGTGTGGGGG - Intergenic
1070545238 10:77446872-77446894 CAGTGTGAACAAAGGTATGGAGG - Intronic
1070680005 10:78442345-78442367 CAAAGTAAACAGAGGATTGTGGG - Intergenic
1070975517 10:80603165-80603187 CTGAGTGGGCAGAGGATTTGAGG + Intronic
1072302646 10:94076466-94076488 CAGTGTGAATGGAGCATTGGAGG + Intronic
1072434245 10:95400974-95400996 CAGATTGCACAGAGGGTTGAAGG + Intronic
1074001207 10:109375109-109375131 CAGAGTGAATGGGGGTTTGGGGG + Intergenic
1074856401 10:117477189-117477211 CAGAGTGAGGAGAGGCTAGGAGG + Intergenic
1075664917 10:124223193-124223215 CTGAGGCAAGAGAGGATTGGGGG + Intergenic
1078438391 11:11344329-11344351 GACAGTGAACTGAGGCTTGGAGG - Intronic
1080514328 11:33006157-33006179 CAGAGTGAACAGATGTCTGGAGG + Intergenic
1082116974 11:48338951-48338973 CAGAGAGAACAGAGGATCGAAGG - Intergenic
1082256817 11:50041358-50041380 CTAAGAGAACAGAGGATTGAAGG + Intergenic
1082632771 11:55560812-55560834 AAAAGTGAAAAGAGGCTTGGAGG - Intergenic
1082705168 11:56485939-56485961 CAGACAGAAAAGAGGTTTGGTGG - Intergenic
1085419506 11:76343437-76343459 CAGAGTGGCTAGAGGATTGGAGG - Intergenic
1087505851 11:99020534-99020556 CAGAGTGAAGACAGGAGCGGAGG + Intergenic
1087963945 11:104389362-104389384 CAGGGTGAACAGAGCAATAGAGG + Intergenic
1088551035 11:111012482-111012504 CGGAGTGAACGGAGGACTGAAGG + Intergenic
1089131347 11:116214769-116214791 CATAATGACCAGAGGAGTGGTGG - Intergenic
1090493074 11:127182940-127182962 CAGAGTGATCACAGGAGTGGAGG + Intergenic
1090924936 11:131241236-131241258 CAGCCTGAAGAGAGGACTGGGGG - Intergenic
1090940874 11:131387338-131387360 CAGAGTGAAGAGGGGAGTGCTGG - Intronic
1091027986 11:132159077-132159099 CAGAATGAAGGGTGGATTGGAGG + Intronic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1091747952 12:3004473-3004495 CCGAATGAACAGGGAATTGGAGG - Intronic
1091754685 12:3043741-3043763 CAGAGTGAACAGGAGAGAGGAGG + Intergenic
1092867771 12:12779068-12779090 CAGAATGGACAAAGGAATGGAGG - Intronic
1093372407 12:18380309-18380331 CAGAGTCAACAGAGGTGAGGAGG - Intronic
1093679274 12:21982044-21982066 AAGACTGAACAGAGAAGTGGAGG - Intergenic
1093748836 12:22775035-22775057 CAGAGAGATCAAATGATTGGTGG + Intergenic
1096497546 12:52047178-52047200 CAGAGTGAACAGCTAATTGTCGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096678823 12:53241633-53241655 CAGTGTGAACAAAGGACTGGAGG + Intergenic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097236397 12:57542946-57542968 CACAGGGAACAGAGGATTCAAGG - Intronic
1097689451 12:62720853-62720875 TAGTGTGAACAGAGATTTGGGGG - Intronic
1099177777 12:79441613-79441635 AAAAGAGAACAGAGGGTTGGGGG - Intronic
1100129481 12:91473860-91473882 CTGAGTAAAAAGGGGATTGGTGG - Intergenic
1100679644 12:96905662-96905684 CAGTGAGGACAGAGGAATGGAGG + Intergenic
1100998543 12:100330714-100330736 CTGAGTGAGCAGAGTTTTGGAGG + Intronic
1101271803 12:103155013-103155035 CACTGTGAAAAGAGGAGTGGGGG - Intronic
1103903175 12:124314148-124314170 CGGAGTGAACCCAGGATTGGGGG - Intronic
1104744456 12:131202348-131202370 CAGCGTGAACAGTGACTTGGGGG - Intergenic
1104789923 12:131474875-131474897 CAGCGTGAACAGTGACTTGGGGG + Intergenic
1106467790 13:30028160-30028182 CAGAGTGAAGAAATAATTGGAGG + Intergenic
1109575266 13:64248528-64248550 CAGAATGAACAAAGGAATGAAGG - Intergenic
1109923450 13:69102076-69102098 CACAAGGAACAGAGGACTGGTGG - Intergenic
1111224272 13:85249036-85249058 CAGAGAGATCAGAGGAAAGGAGG + Intergenic
1111428457 13:88121008-88121030 CAGAGTGAACAGACAATGTGTGG - Intergenic
1114971544 14:28035908-28035930 CAGAGTGAACAGACAATCTGTGG + Intergenic
1117122131 14:52579423-52579445 CAGAGAGAACTGAGAAGTGGGGG - Intronic
1117498828 14:56331774-56331796 AAGAGTGGACAGAGGAGTTGAGG + Intergenic
1118244206 14:64092900-64092922 CAGACTGAACAGAGCATGTGAGG - Intronic
1118735134 14:68695697-68695719 CAGGGTGACCAGAGGCTTGTGGG - Intronic
1119129424 14:72157815-72157837 AAGAATGAACAAAGGAATGGTGG - Intronic
1119552667 14:75526224-75526246 CAGAGTGAAGAGAGGTAAGGTGG - Intronic
1119871122 14:78018401-78018423 GAAAGTTAAAAGAGGATTGGGGG + Intergenic
1120880502 14:89412173-89412195 CAGAGTGGGCAGGGGATGGGGGG + Exonic
1121057681 14:90873689-90873711 CGGAGTCATCAGAGGATTGGAGG + Exonic
1121412351 14:93756772-93756794 CTGGGTGAATGGAGGATTGGGGG - Intronic
1123130871 14:105984302-105984324 CTTGGTGAACAGAGGATGGGAGG - Intergenic
1123581098 15:21715523-21715545 CTTGGTGAACAGAGGATGGGGGG - Intergenic
1123617747 15:22158146-22158168 CTTGGTGAACAGAGGATGGGGGG - Intergenic
1123787859 15:23690523-23690545 CATAGTGAACGGAGGAAGGGGGG + Intergenic
1126169735 15:45685345-45685367 GGGTCTGAACAGAGGATTGGTGG - Intronic
1127848194 15:62889977-62889999 CTGTGTGAGCAGAGGCTTGGAGG + Intergenic
1128093021 15:64931674-64931696 CTGAGTGAATAGAGGCTTCGAGG + Intronic
1128114774 15:65098293-65098315 CAGTGTGAATAAAGGAGTGGAGG - Intronic
1130919967 15:88335606-88335628 CAGCATGAACAGAGGCTTGGAGG + Intergenic
1131177320 15:90218162-90218184 CAGCGTGAACAGAGATTGGGTGG + Intronic
1134634074 16:15778921-15778943 CAGATGGTACAGAGGATGGGAGG + Intronic
1135091431 16:19521408-19521430 CAGAGTGTACATCGGAATGGGGG - Intronic
1135256322 16:20944419-20944441 CAGTGGGCACACAGGATTGGAGG - Intronic
1136045072 16:27609018-27609040 CAGCATGAACAAAGGTTTGGGGG - Intronic
1137935369 16:52630153-52630175 GAGAGTGAACAGAGGGGAGGAGG + Intergenic
1138370218 16:56520646-56520668 AAGAGGGGAGAGAGGATTGGAGG + Intergenic
1139663565 16:68439291-68439313 CAGAGTGAACCAAGGAACGGGGG - Intronic
1139946925 16:70647993-70648015 CAGTGTGAGCAAAGGTTTGGCGG + Intronic
1141859028 16:86704087-86704109 CAGAGTGAAAAGGGCATTGCAGG + Intergenic
1142105906 16:88302647-88302669 AAGAGTGAACAGACGTTGGGAGG + Intergenic
1142564019 17:827834-827856 CAGAGGGAAGAGGGCATTGGTGG + Intronic
1142614006 17:1124702-1124724 CAGAGTGAACAGAGGAGGGCTGG + Intronic
1142909274 17:3073064-3073086 CAGAGTGCCAAAAGGATTGGAGG + Intergenic
1142925286 17:3231174-3231196 CAGAGTGCCAAAAGGATTGGAGG - Intergenic
1144144974 17:12388577-12388599 CAGATTTAAGAGAGAATTGGAGG + Intergenic
1145294643 17:21578568-21578590 CAGAGCAGACAGAGGCTTGGTGG + Intergenic
1147166445 17:38596081-38596103 CAGAGGGAACAGAGTCCTGGAGG + Intronic
1148634117 17:49133965-49133987 CACGTTGAATAGAGGATTGGCGG + Intronic
1149085490 17:52710405-52710427 GAGGATGAACAGAGGACTGGAGG + Intergenic
1149662234 17:58340110-58340132 CAGAGTCTACAGAGGAGTGAAGG - Intergenic
1151375781 17:73687895-73687917 CAGGCTGAAGAGAGGATTTGAGG + Intergenic
1151458651 17:74241794-74241816 GAGAGTGGACAGAGGAGGGGCGG - Intronic
1152374894 17:79913901-79913923 CAAAGTGGACAAAGGTTTGGGGG + Intergenic
1152490047 17:80625076-80625098 CAGAGGGAACTGTGGATTTGAGG + Intronic
1153930200 18:9871504-9871526 CAGAGTCACCATAGAATTGGGGG + Intergenic
1154023611 18:10686428-10686450 CAGAGACAAGAGAGGATGGGTGG + Intronic
1157434443 18:47656570-47656592 CAGCATGAACAGAGGCTTGTGGG + Intergenic
1157452475 18:47799168-47799190 GAGACTGAACAGAGGCTTGCTGG + Intergenic
1157501607 18:48194553-48194575 CAGAGTAAACAGAGGCTTGCAGG + Intronic
1157972221 18:52283772-52283794 CAAGGTGAACAGTGGATAGGGGG - Intergenic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1162225592 19:9219095-9219117 CAGAGTGGTCTGGGGATTGGGGG - Intergenic
1162467028 19:10848579-10848601 CAAGGTGGACAGAGGATGGGGGG - Intronic
1162472800 19:10882510-10882532 CAGAGTGCACTGGAGATTGGGGG - Intronic
1163326228 19:16605014-16605036 CGGGGTGAACTGGGGATTGGTGG + Intronic
1165092749 19:33395416-33395438 CTGAGTACACAGAGGAGTGGGGG - Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1166367839 19:42286259-42286281 CATAGTGAACGGAGAGTTGGAGG + Intronic
1166567886 19:43776251-43776273 CAGAGTGGACAGAGGCCTGGGGG + Intronic
1166720209 19:44992171-44992193 CAGAGTGCACAGGGGAGAGGTGG + Intronic
1166911900 19:46164839-46164861 CTTCGTGAACAGAGGATGGGTGG + Intergenic
1167024228 19:46903210-46903232 CAGAATGAAGAGAGGGTTTGGGG - Intergenic
1168179246 19:54649423-54649445 CACGGTTAACAGAGGCTTGGGGG + Intronic
1168337460 19:55604701-55604723 CTGAGGGAACAGGGTATTGGAGG + Intergenic
1168579528 19:57543071-57543093 CAGAGTGATCAGAAGAGTGTAGG - Exonic
925162060 2:1692468-1692490 CAGGGTCAACAGTGGATAGGCGG + Intronic
925224081 2:2167480-2167502 CAGTGTGAAGTGTGGATTGGAGG - Intronic
925392255 2:3503894-3503916 CCGAGTGAACAGAGAAGAGGGGG + Intronic
925663883 2:6232306-6232328 CAGAGAGCACAGAGGAAAGGAGG - Intergenic
925718495 2:6806740-6806762 CAGTGGGGACAGAGGATGGGAGG + Intergenic
927279154 2:21288478-21288500 CAGAGTGAACAAAGGGCTGTAGG + Intergenic
928077434 2:28278019-28278041 CAGAGAGAACAGTGTATTCGTGG + Intronic
929072503 2:38047954-38047976 CAGAGTGATCAGAGTATTTTAGG - Intronic
929568037 2:43001915-43001937 CACAATGAACAGTGGAATGGGGG + Intergenic
929971376 2:46580187-46580209 GAGAGGGAACAGAGGCTTGTAGG - Intronic
931167265 2:59761526-59761548 CAGGGTGATCAGAGGATTCCTGG + Intergenic
931543836 2:63358753-63358775 TAGAGTTAAGAGAGCATTGGAGG - Intronic
931783015 2:65596159-65596181 CATAGAGAACAGAGAGTTGGAGG - Intergenic
932570957 2:72938187-72938209 CAGGGGGAAGAGAGGCTTGGAGG - Intergenic
935048779 2:99506085-99506107 CAGAGTGAACCAAGGGGTGGTGG - Intergenic
935050354 2:99519997-99520019 CAGAAGGTAGAGAGGATTGGTGG - Intergenic
935601337 2:104925192-104925214 CAAAGTGAAGACAGGATTGCTGG - Intergenic
937893367 2:126957416-126957438 AAAAGTTACCAGAGGATTGGTGG + Intergenic
938072308 2:128315182-128315204 AAGAGTGAGCAGAGCATTGGCGG - Intronic
938782952 2:134601970-134601992 CAGCTTGAACAAAGGCTTGGAGG + Intronic
941083175 2:161086099-161086121 CAGAGTGGAGAATGGATTGGAGG + Intergenic
942328867 2:174800637-174800659 CAGAGTGAAGGGAGGGTGGGTGG - Intronic
944963740 2:204905705-204905727 CAAAGTGAACAGAGGAAGAGTGG + Intronic
945160201 2:206882756-206882778 CAGAATGAACAGTGGAGTAGAGG - Intergenic
945853163 2:215034407-215034429 CAGAGTGTGGAGAGGAATGGGGG + Intronic
946525371 2:220513259-220513281 CAGAGTGAACAGAGCATCAAGGG + Intergenic
947269399 2:228317203-228317225 CACAGTAAAAAGAGGAATGGAGG - Intergenic
947870520 2:233435102-233435124 CAGAGTGAAAAGGGAAGTGGTGG + Intronic
948082711 2:235219801-235219823 CAGAGTGACCTGGGGCTTGGAGG + Intergenic
1168833213 20:858848-858870 CAGAGAGCACAGAGGACTTGAGG + Intergenic
1168949016 20:1783811-1783833 CATAGTGAACAGAGCATTGCTGG + Intergenic
1169046992 20:2541024-2541046 CAGAGGAAACAGGGGATTGAGGG - Intronic
1170098676 20:12674919-12674941 AAGAGTGGACAGAGGCTTGGTGG - Intergenic
1170994901 20:21344436-21344458 CAGAGGGAAAAGTGGATTGGAGG - Intronic
1171950342 20:31415819-31415841 CAGTGTGAACTGAGGAGTGGTGG + Intergenic
1172834353 20:37863538-37863560 CAGAGGGAGCAGAGGCCTGGAGG + Intronic
1172892896 20:38279532-38279554 CAGCATGAGCAGAGGTTTGGAGG + Intronic
1172912553 20:38420775-38420797 CAGATTGAACAGTGGATCCGGGG + Intergenic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1173198319 20:40934354-40934376 CTGAGTGAACAATGGATTAGGGG + Intergenic
1173665041 20:44757261-44757283 CAGAGTGAGCAAAGGAAGGGTGG - Intronic
1174615470 20:51832281-51832303 CAGAGTGAACACTGGCTTGCCGG - Intergenic
1175225118 20:57440114-57440136 CAGAGTGAGCAGTGGAGTTGGGG - Intergenic
1176141113 20:63545494-63545516 CAGAGTCAACACAAGATTCGGGG + Intronic
1179786570 21:43733673-43733695 CACACTGAACAGAGGCTGGGAGG - Intronic
1180014123 21:45071919-45071941 CACAGTGAACAGGGGATGGATGG + Intergenic
1180261796 21:46675258-46675280 CAGAGGGAACAGAAGGTTGGAGG - Intergenic
1181901819 22:26162260-26162282 ATGAGTAAACAGAGGCTTGGAGG - Intergenic
1182327667 22:29525994-29526016 CAGAGTGAACAGAGTCATAGGGG + Intronic
1182485615 22:30636872-30636894 CAGGGTGAACAGAGGTGTGGTGG - Exonic
1182574935 22:31266648-31266670 CTGAGTGAACAGAAGTCTGGGGG - Intronic
1183991037 22:41597178-41597200 AAGGGTGAACCGAGGCTTGGAGG + Intergenic
1184967657 22:47992831-47992853 CAGGCTGAAGAGAGGATTGCAGG - Intergenic
950041212 3:9920626-9920648 CAGAGGGGACAGAGGCTAGGGGG - Intronic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
953789206 3:45934083-45934105 CACAGGGAAAAGAGAATTGGGGG + Intronic
954443123 3:50532609-50532631 CGGAGTGAGCAAAGGCTTGGAGG + Intergenic
955399468 3:58581230-58581252 CAGAGTTAAAAGGGGATGGGAGG - Intronic
956250629 3:67230623-67230645 CTTGGTGAACAGAGGATGGGTGG - Intergenic
959155487 3:102662037-102662059 CAGAGCGAACAAAGGTTTGGAGG + Intergenic
960048738 3:113221249-113221271 CAGAGTGAAAGGAGGGTTGCTGG + Intronic
961171302 3:124799694-124799716 CAGAGAGAAAACAGGGTTGGCGG + Intronic
961248899 3:125482558-125482580 CAGAGTGGACAGTAGATTAGAGG - Intronic
962176476 3:133160693-133160715 CAAAGTCAACAGAGGTTTGAAGG - Intronic
962207216 3:133444866-133444888 CTGTGGGAAGAGAGGATTGGAGG - Intronic
962783980 3:138749412-138749434 TAGAATGAAGAGTGGATTGGAGG - Intronic
962894395 3:139700840-139700862 AAGAGAGAACAGAAGATTGGTGG + Intergenic
965402831 3:168233713-168233735 CAAAGTAAAGAGAGGCTTGGTGG - Intergenic
966191885 3:177278951-177278973 CAGACTGTACTGAAGATTGGAGG - Intergenic
968772217 4:2514691-2514713 CAGTGGGAACTGAGGACTGGAGG - Exonic
969353923 4:6614179-6614201 CAGAGTGAGGAGAGGGTTTGGGG - Intronic
970550730 4:17178405-17178427 CAGAGTGAACAGGGAAATGGAGG + Intergenic
970986283 4:22162632-22162654 CAGACAGTACAGAGGATTGCTGG - Intergenic
972957651 4:44412363-44412385 AAGAGTCAACAAAAGATTGGTGG - Intronic
973047171 4:45549174-45549196 CAGAGTGGCCAGAGGCTTTGGGG + Intergenic
973316863 4:48769872-48769894 TAGAGTGAAAAGAGAATTAGTGG + Intronic
975350614 4:73341675-73341697 CAGACTGAACAGCTGACTGGGGG + Intergenic
977343383 4:95788655-95788677 CAGAGTGAACACAGCATTTCTGG + Intergenic
978458586 4:108924667-108924689 CAGTGTGCAGAAAGGATTGGAGG - Intronic
979357997 4:119728606-119728628 CAGAGTAAAGGGTGGATTGGGGG + Intergenic
979615336 4:122735898-122735920 CAGAGGGAAAAGAGGATTTGTGG + Intronic
980492407 4:133544996-133545018 CAGTGTGAAGAAAGGATTAGAGG + Intergenic
981019788 4:140013456-140013478 CAGAGATAACATAGGATTTGCGG - Intronic
981664569 4:147208519-147208541 CAGAGTAACTGGAGGATTGGTGG - Intergenic
985151742 4:186954306-186954328 CACAGTGAACTGGGGATTGCGGG + Intergenic
985548573 5:522005-522027 CAGAGTGCACAGTGGGTTGAGGG + Intronic
985911441 5:2887044-2887066 GAGAGTGAACAGAGAACTAGAGG - Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
987138653 5:14922660-14922682 AAGAGCTAACAGAGGATGGGCGG + Intergenic
987160303 5:15134642-15134664 CAGAAAGTACAGAGGGTTGGGGG - Intergenic
987752035 5:22052435-22052457 CAGCATGAACAGGGGATTAGAGG - Intronic
988193493 5:27969208-27969230 CTGAGGGAACAGAGGCTTGAAGG - Intergenic
989644784 5:43619678-43619700 CTGAGTGTACATAGGATTGAAGG - Intronic
990156834 5:52887300-52887322 GAGAGAGAACAGAGTATTAGTGG - Intronic
990986820 5:61648467-61648489 CAGAGTGAACAAAGGAAAGTAGG + Intronic
991041349 5:62178798-62178820 AAGACTGAAGAGAGGAGTGGAGG + Intergenic
991922640 5:71671920-71671942 CAATGTGAAGAGAGCATTGGAGG - Intergenic
992372110 5:76153798-76153820 AAGAATGGACAGAGGCTTGGAGG + Intronic
992607254 5:78471188-78471210 CAAAATGTACAAAGGATTGGCGG + Intronic
993168820 5:84389434-84389456 CAGCATGAGCAGAGGGTTGGAGG - Intergenic
994290010 5:98018041-98018063 CAGTGTTAACAAAGGATTTGAGG + Intergenic
995049278 5:107684061-107684083 AAGAGTGCACAGAGTATTTGGGG + Intergenic
996135316 5:119834310-119834332 CAGAGTGGAGAGAAGATGGGAGG - Intergenic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
1000721044 5:164707624-164707646 CAGCGTGAAGAGTGGAGTGGGGG - Intergenic
1000956986 5:167554905-167554927 CAGAGTAGACAGATGCTTGGGGG + Intronic
1001285311 5:170418744-170418766 CAGTGTGAACAAAGGCTAGGAGG - Intronic
1001654147 5:173336518-173336540 CAGAGTTAACTGAGGCTTGGAGG - Intergenic
1001788296 5:174432688-174432710 GAGAGGGATCAGAGGGTTGGAGG + Intergenic
1003938668 6:11002181-11002203 CACAGTGGACAGAGGATCAGTGG - Intronic
1004011083 6:11688017-11688039 CCGAGTTAGCAGAGGATTGTAGG - Intergenic
1004249951 6:14015616-14015638 GAGAGAGAGCAGAGGAATGGAGG - Intergenic
1006184224 6:32171231-32171253 CAAAGTGAGTAGTGGATTGGGGG - Exonic
1006247910 6:32756524-32756546 CAGAGGGAACTGAGGACTAGGGG - Intronic
1007931019 6:45690588-45690610 CTGAGTGGACAGAGGCTTGTGGG + Intergenic
1008480276 6:51978543-51978565 TAAAGTCAACAGAGGATTAGGGG + Intronic
1008547477 6:52595993-52596015 CAGCCTGAACAGAGAGTTGGGGG - Intergenic
1010584025 6:77635414-77635436 AAAAATGAACAGAGGATTTGGGG + Intergenic
1011894715 6:92211261-92211283 CAGAGAGAAGAGAGTTTTGGAGG - Intergenic
1013563413 6:111329855-111329877 CAGAGTGACCATAGTATTAGTGG + Intronic
1014727460 6:124989481-124989503 CATAGTGAACTGAGCAATGGTGG + Intronic
1015184199 6:130394784-130394806 CAGGGTAAACAGAGGATAGTGGG + Intronic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015898083 6:138036214-138036236 CAGAGGGCACAGAGGCCTGGGGG + Intergenic
1017666045 6:156721041-156721063 CAGAGAGGAGAGAGGATTAGAGG + Intergenic
1019319154 7:407658-407680 CAGAGTGGGCACAAGATTGGGGG + Intergenic
1020678163 7:11204352-11204374 CAGTGAGGACAGAGGAGTGGAGG + Intergenic
1021936094 7:25632835-25632857 CAGAGTGAGTAGAGGATTAATGG + Intergenic
1022258484 7:28682308-28682330 CACAGTGGACAGAGGATGAGGGG - Intronic
1024951073 7:54860846-54860868 CAGAGAGAACAGAGGAAGGGAGG + Intergenic
1025284885 7:57653154-57653176 CAGAGAGAAGAGAGAATGGGAGG + Intergenic
1026266937 7:68803421-68803443 CAGAGAGAAAAAGGGATTGGGGG + Intergenic
1027126673 7:75561355-75561377 CAGAGAGATCAGTGGATTGAAGG - Exonic
1027732199 7:81888553-81888575 CACAGTGAAAAGAGATTTGGAGG + Intergenic
1028438833 7:90835403-90835425 CAGAGAGAACAGATAATTGCTGG + Intronic
1029699771 7:102238710-102238732 CAGAGTGAAAAGTGGGGTGGGGG - Intronic
1031857100 7:126936449-126936471 GAGAGTGAACAGCGGATAGTGGG - Intronic
1032333183 7:130999416-130999438 CTCAGTGAACACAGGCTTGGGGG + Intergenic
1032526883 7:132584877-132584899 GAGAGTGAGCAGAGGACTGGCGG - Intronic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1034502640 7:151460738-151460760 CACAGTGATCCGAGGATTGCAGG - Intergenic
1035064921 7:156097324-156097346 AAGAGAGAACACAGGCTTGGGGG + Intergenic
1035692368 8:1568598-1568620 CTGAGTGAACAGTGGCATGGGGG - Intronic
1036428618 8:8669127-8669149 CAAAATGAACAGAGGGTTGGTGG - Intergenic
1036703819 8:11031731-11031753 CAGAGTTAGGAGAGGTTTGGAGG - Intronic
1038543111 8:28405251-28405273 CAGAGTGAATGGAGGGTTGGAGG + Intronic
1038679948 8:29657608-29657630 CAGAGAGGACAGAGCATTTGAGG - Intergenic
1042338183 8:67650801-67650823 CAAATTGCACAGAGGATTGATGG + Intronic
1042506607 8:69567180-69567202 CACAGTGAACTGTGGGTTGGAGG + Intronic
1043372888 8:79613161-79613183 CATAGAGAACAGAGGGTGGGCGG - Intronic
1043450838 8:80364869-80364891 CAGAGTGTACAGAGACTTTGAGG + Intergenic
1044340318 8:91040133-91040155 CTGAGTGAACAGAGCACTGTTGG + Intronic
1044678059 8:94749433-94749455 CACACTGAACAAAGGAGTGGAGG + Intronic
1045415022 8:101957619-101957641 CAAAGTGAACAGAGCACTTGAGG + Intronic
1045441835 8:102221543-102221565 AAGAGTGAAGAGTGCATTGGTGG - Intronic
1046350621 8:113006341-113006363 CAGAGTTAAAAGAAGACTGGTGG + Intronic
1047252683 8:123192600-123192622 CTGGGTGAACAGCTGATTGGTGG + Intronic
1047670018 8:127135953-127135975 CAGAGTGAGAAGAGGGCTGGAGG - Intergenic
1048593171 8:135840380-135840402 CATATTGAACAGTGAATTGGAGG + Intergenic
1048999654 8:139816529-139816551 CAGAGGGGACAGAGGAGAGGTGG + Intronic
1049215211 8:141404661-141404683 CTGAGTCAGCAGAGGCTTGGGGG + Intronic
1049867499 8:144948304-144948326 CAGGGTGCTCAGAGGAATGGTGG + Intronic
1052748390 9:32464028-32464050 CAGAGTGACCAGAGAATTCTGGG + Intronic
1053442931 9:38130752-38130774 CAGAGTGAGCAGTGGAATGAAGG + Intergenic
1055572800 9:77633570-77633592 CAGAGTGAATAGTGAATTTGGGG + Intronic
1055670433 9:78600183-78600205 AAGAGAGCTCAGAGGATTGGTGG + Intergenic
1056412546 9:86345332-86345354 CAGTGGTAACAGAGGATAGGTGG + Intronic
1057263237 9:93597930-93597952 CAGAGTGCCCAGAGGAGTAGAGG - Intronic
1057393435 9:94658279-94658301 CAGAGAGAACAGGGGATCTGAGG - Intergenic
1057448757 9:95137897-95137919 CAGAGAGAGGAGAGGAGTGGAGG + Intronic
1058341878 9:103907228-103907250 CAAAGTGAATAAAGGATTGTAGG + Intergenic
1060268776 9:122127142-122127164 CTGAGAGAACACAGGTTTGGGGG + Intergenic
1186474601 X:9847534-9847556 CAGAGGGAAAAGGGGGTTGGAGG + Intronic
1186957583 X:14700268-14700290 CAGAGTGAGAAGAGAAGTGGAGG + Intronic
1187904736 X:24055062-24055084 CAGAGTGAGCTCAGGAGTGGAGG + Intronic
1188404972 X:29796826-29796848 CAGAGTGAACAGGAAATTGATGG - Intronic
1192205939 X:69096236-69096258 CAGAGTGGCGAGAGGATTGTAGG + Intergenic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1192801422 X:74467967-74467989 CAGCATGAACAGTGGTTTGGAGG - Intronic
1196411223 X:115421519-115421541 CACAGTGAACAGAGTATTAGTGG - Intergenic
1198822620 X:140665235-140665257 CAGAGTTAAAAGAGGATTTAGGG + Intergenic
1200984695 Y:9292642-9292664 CAGAGTGAAGGGAGGATGTGAGG - Intergenic