ID: 909958627

View in Genome Browser
Species Human (GRCh38)
Location 1:81807499-81807521
Sequence CCTAAGATGCTCTCAAAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909958627 Original CRISPR CCTAAGATGCTCTCAAAGAT TGG Intronic
906747141 1:48230053-48230075 CTTAGGATGTTCTCAAATATTGG - Intronic
908334333 1:63105011-63105033 CCTCAGCTGTTCTGAAAGATGGG + Intergenic
909850046 1:80450137-80450159 CATATGATTTTCTCAAAGATAGG - Intergenic
909958627 1:81807499-81807521 CCTAAGATGCTCTCAAAGATTGG + Intronic
911036523 1:93555875-93555897 CATAAGATGCACCAAAAGATTGG + Intergenic
911358835 1:96852511-96852533 CCTAATCTGCTATCAAACATTGG + Intergenic
916175343 1:162033486-162033508 CCTGAGGTGTTCTCAGAGATGGG + Intergenic
918398927 1:184144459-184144481 CCTAAGAAGCCCTCCTAGATTGG + Intergenic
919353214 1:196486682-196486704 CCCAAGATGAACTCAAAGACTGG + Intronic
1062929409 10:1342566-1342588 CCTGAGATGCTCTCAGACATGGG + Intronic
1063879512 10:10516963-10516985 CCTACGGTTCTCTCAAAGAGGGG - Intergenic
1064323345 10:14326864-14326886 CCTGAGATTCTTGCAAAGATGGG + Intronic
1064859481 10:19811992-19812014 CCTAAATTGTACTCAAAGATAGG - Intergenic
1064893328 10:20205470-20205492 TCTAAGTTGCTCTCACATATGGG - Intronic
1067339127 10:45386944-45386966 GATAAGATGCTCTCAGAGCTAGG + Intronic
1069016645 10:63437052-63437074 ACTAAGATGCATTCAGAGATGGG - Intronic
1069735722 10:70652864-70652886 CCTAAGATTCTTACTAAGATGGG - Intergenic
1072316794 10:94211173-94211195 CCTCAGATGGCCTAAAAGATGGG - Intronic
1074399955 10:113133853-113133875 CCTAGGAGGCTCTCAGGGATTGG + Intronic
1078007574 11:7544073-7544095 CCTCAGATGCTGTCCCAGATAGG + Intronic
1083067891 11:59944533-59944555 CCTCCTATGCTGTCAAAGATTGG + Intergenic
1085691642 11:78669143-78669165 CCTATGATGATCTGAAAGTTGGG + Exonic
1086016795 11:82177981-82178003 CCTAAGATGCTCATGAAGAGTGG + Intergenic
1086182746 11:83974011-83974033 CCTAACTACCTCTCAAAGATGGG + Intronic
1086433726 11:86760895-86760917 CCTAACATGCTCTGAAACAAAGG + Intergenic
1086768765 11:90733701-90733723 CTTCAGATGCTCTGAAATATAGG + Intergenic
1087641351 11:100757955-100757977 ACTAAGGTTCTCTTAAAGATTGG - Intronic
1090257829 11:125298240-125298262 CATAGGATGCTCTTAAAGCTGGG + Intronic
1090978440 11:131695323-131695345 CCTGAGATGATGTCAAAGACTGG + Intronic
1092461634 12:8692127-8692149 TCTAAGATCCTCCCAAAGACAGG + Intronic
1095373392 12:41496918-41496940 CTTATGTTGCTCTCATAGATAGG + Intronic
1098624367 12:72644493-72644515 CCTAAGAGGCTGTCAAGAATTGG - Intronic
1099965298 12:89439231-89439253 CCTATGATCCTCTCTAAGCTTGG + Intronic
1101437558 12:104677142-104677164 CCTAATTGGCTCTCAAAAATGGG + Intronic
1102384368 12:112495320-112495342 CCTAAGAAGCTGTCGCAGATTGG - Intronic
1103153864 12:118666571-118666593 CCCAAGAAGCTCCCAATGATCGG + Intergenic
1114930760 14:27465120-27465142 ATTAAGATGCTCTCAAGGTTGGG - Intergenic
1118077246 14:62313098-62313120 CCAAAGAGGCTTTGAAAGATAGG - Intergenic
1118153304 14:63213062-63213084 GCTAAGATGCTGTAACAGATAGG + Intronic
1119940748 14:78638666-78638688 CCTAAGAGGCTCTTAGAGGTAGG + Intronic
1120122480 14:80698955-80698977 CCTAAATTACTCTCAAAGAAAGG + Intronic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1124857289 15:33401760-33401782 TCTAAGATGCTGTCAAATATAGG - Intronic
1125360122 15:38856415-38856437 CTTAAAATGCGCTCATAGATTGG - Intergenic
1125793690 15:42388939-42388961 CCTACGAAGCTCTGAAAGGTGGG + Exonic
1127178629 15:56389909-56389931 CCCAAGATGCTCCCTAGGATAGG + Intronic
1127654941 15:61046948-61046970 CAAAAGATGCTCTCCAAGAAGGG - Intronic
1134304593 16:13020869-13020891 CGTATAATGCTCTCAAAGAAGGG - Intronic
1135510304 16:23077225-23077247 CACAAGATGCGCTCAAAGTTGGG + Intronic
1140438769 16:74970389-74970411 CCTAAGAAGCTCTCCCAGAATGG + Intronic
1143460827 17:7102433-7102455 CCTCAGAAGCTCTCTAAGATGGG + Intronic
1149220445 17:54411006-54411028 CCTAAGATACCCACACAGATGGG + Intergenic
1150835846 17:68563608-68563630 CCTAAGATGATCTTATAGGTGGG + Intronic
1153998294 18:10461398-10461420 CATAAAATGGTCTCAAACATTGG - Intronic
1157434771 18:47659052-47659074 CCTCAGGTGCCCTCACAGATAGG - Intergenic
1159026174 18:63183895-63183917 CTTAAGATACACTCAAAGAAGGG - Intronic
1160095665 18:75870240-75870262 GCAAAGAGGCTCTCAAAGACAGG + Intergenic
1161920683 19:7263365-7263387 GCTGAGTTGCTCTCAAAGACAGG + Intronic
1164725358 19:30462195-30462217 CCTAAGATGCTCTTGGAGAAAGG + Intronic
1167604748 19:50475837-50475859 ACGAAGTTGCTCTCAAAGATGGG + Exonic
937260846 2:120586146-120586168 CCCAAGATGCTCACATAGAGAGG + Intergenic
937459170 2:122070579-122070601 CATAACATGCTCACAAAGGTGGG - Intergenic
939297196 2:140282573-140282595 CCTAAGATGTCCACAGAGATGGG - Intronic
1170338686 20:15299240-15299262 CTTAAGATAGTCTCAAAAATGGG - Intronic
1172760750 20:37319644-37319666 CTTAAGATGCTCTTTAAGATAGG - Intergenic
1181581765 22:23832646-23832668 CCAAAGCTGCTCTCAGAGGTGGG + Intronic
1184441697 22:44520899-44520921 CCTAAGATGCCCCCAAGCATGGG - Intergenic
952944359 3:38467540-38467562 CCTAAGATGGTCTCAAACTCTGG - Intronic
953172794 3:40523237-40523259 CCTAAGATACTCTCCATAATAGG + Intergenic
955092848 3:55769408-55769430 CCTAAGATGTGCTCAGAAATAGG - Intronic
958887887 3:99748711-99748733 CCTAAGATGCTGTCAAATAGAGG + Intronic
961891194 3:130131478-130131500 CCGAAGATTCTCTCAAAACTAGG + Intergenic
964271625 3:154962703-154962725 ACTAAGATGATTTCAAAGCTTGG - Intergenic
965232435 3:166071275-166071297 CCTATGGTGCTCTCAAGGGTTGG + Intergenic
966114279 3:176443429-176443451 CCTAAGAAGCTATCTAACATAGG + Intergenic
971172052 4:24243371-24243393 CCTTAGATGATTTCAGAGATGGG - Intergenic
971573806 4:28248506-28248528 CCTAAGTTGCTCTCACACTTAGG - Intergenic
971905015 4:32715281-32715303 CCTAAGATACTCTCTGAGGTGGG + Intergenic
976303741 4:83538992-83539014 GCTCAGATGCTCCCAAACATAGG - Intronic
976821707 4:89214252-89214274 CCTGAGATGCTTTCAAAGACTGG + Intergenic
977854594 4:101874733-101874755 CATAATATGCTCTAAAAGAGTGG - Intronic
980549125 4:134310179-134310201 GCTTAGATGCTTCCAAAGATGGG - Intergenic
990494644 5:56335202-56335224 CCATAGCTGCTCTCAAAGGTTGG + Intergenic
993159181 5:84266626-84266648 CCTCTGATGCTCTCAGAGTTTGG + Intronic
1002529960 5:179838367-179838389 CCAAAGATGCTCTGAAAGTTGGG + Intronic
1008638527 6:53436825-53436847 CCTAAGAGGCCATCACAGATTGG + Intergenic
1012944168 6:105448340-105448362 CAGAGGATGCTCTCATAGATAGG - Intergenic
1014633319 6:123813929-123813951 CCTGAGATTTTCTCAAATATTGG + Intronic
1014903085 6:126992503-126992525 CTGAAAATGCTATCAAAGATAGG + Intergenic
1016393585 6:143599100-143599122 CCTAAGCTGATCTGAAAAATTGG + Intronic
1021499614 7:21317395-21317417 ATTAATATTCTCTCAAAGATTGG - Intergenic
1024203978 7:47137557-47137579 CATAACATGTTTTCAAAGATAGG - Intergenic
1026261910 7:68762656-68762678 CCTAAGATGCCCTGAGAGGTGGG - Intergenic
1028949112 7:96614283-96614305 CCTAATATGCTCTTAAATTTCGG + Intronic
1030156891 7:106464667-106464689 CCTAAACAGCTCTAAAAGATAGG - Intergenic
1031147417 7:118012276-118012298 CCAAAGATGGTCTCACACATGGG - Intergenic
1040389028 8:46933785-46933807 CTTAAGACCCTCTCAAAGGTGGG - Intergenic
1047268970 8:123336807-123336829 CTTAAGTTGCTCTGAAGGATGGG - Intronic
1051682231 9:19619040-19619062 CCTAAGCAGTTCTCAAAGACAGG + Intronic
1052466966 9:28840592-28840614 CCTAGGATGCTTTCAAGGATGGG + Intergenic
1052641690 9:31175643-31175665 GGTAAGATGCGCTTAAAGATAGG - Intergenic
1055646216 9:78363855-78363877 TCTAAGATGGCCTCCAAGATTGG - Intergenic
1056324999 9:85470091-85470113 GCTAATATGCTATGAAAGATTGG + Intergenic
1061128616 9:128692558-128692580 CCAAAGATGCTCACTAAGTTCGG + Intronic
1189870667 X:45379977-45379999 CCTAATTTGCTATCAAACATTGG + Intergenic