ID: 909988237

View in Genome Browser
Species Human (GRCh38)
Location 1:82188859-82188881
Sequence GCAGACTCATGAGCCAAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909988237_909988246 18 Left 909988237 1:82188859-82188881 CCCGTTTTGGCTCATGAGTCTGC No data
Right 909988246 1:82188900-82188922 GGGAGTTCTAGGGAAGTGGAAGG No data
909988237_909988241 -3 Left 909988237 1:82188859-82188881 CCCGTTTTGGCTCATGAGTCTGC No data
Right 909988241 1:82188879-82188901 TGCAATAGGCTGTCAATGGAAGG No data
909988237_909988244 8 Left 909988237 1:82188859-82188881 CCCGTTTTGGCTCATGAGTCTGC No data
Right 909988244 1:82188890-82188912 GTCAATGGAAGGGAGTTCTAGGG No data
909988237_909988242 -2 Left 909988237 1:82188859-82188881 CCCGTTTTGGCTCATGAGTCTGC No data
Right 909988242 1:82188880-82188902 GCAATAGGCTGTCAATGGAAGGG No data
909988237_909988248 27 Left 909988237 1:82188859-82188881 CCCGTTTTGGCTCATGAGTCTGC No data
Right 909988248 1:82188909-82188931 AGGGAAGTGGAAGGCACACTGGG No data
909988237_909988243 7 Left 909988237 1:82188859-82188881 CCCGTTTTGGCTCATGAGTCTGC No data
Right 909988243 1:82188889-82188911 TGTCAATGGAAGGGAGTTCTAGG No data
909988237_909988245 14 Left 909988237 1:82188859-82188881 CCCGTTTTGGCTCATGAGTCTGC No data
Right 909988245 1:82188896-82188918 GGAAGGGAGTTCTAGGGAAGTGG No data
909988237_909988247 26 Left 909988237 1:82188859-82188881 CCCGTTTTGGCTCATGAGTCTGC No data
Right 909988247 1:82188908-82188930 TAGGGAAGTGGAAGGCACACTGG No data
909988237_909988240 -7 Left 909988237 1:82188859-82188881 CCCGTTTTGGCTCATGAGTCTGC No data
Right 909988240 1:82188875-82188897 AGTCTGCAATAGGCTGTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909988237 Original CRISPR GCAGACTCATGAGCCAAAAC GGG (reversed) Intergenic
No off target data available for this crispr