ID: 909988285

View in Genome Browser
Species Human (GRCh38)
Location 1:82189579-82189601
Sequence CCATTAGGCTGGTGATGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909988285_909988295 13 Left 909988285 1:82189579-82189601 CCTCCTCATCACCAGCCTAATGG No data
Right 909988295 1:82189615-82189637 TACAAGGATGAGAAGGCTTAGGG No data
909988285_909988292 -3 Left 909988285 1:82189579-82189601 CCTCCTCATCACCAGCCTAATGG No data
Right 909988292 1:82189599-82189621 TGGGCTGATTGGCATTTACAAGG No data
909988285_909988293 6 Left 909988285 1:82189579-82189601 CCTCCTCATCACCAGCCTAATGG No data
Right 909988293 1:82189608-82189630 TGGCATTTACAAGGATGAGAAGG No data
909988285_909988294 12 Left 909988285 1:82189579-82189601 CCTCCTCATCACCAGCCTAATGG No data
Right 909988294 1:82189614-82189636 TTACAAGGATGAGAAGGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909988285 Original CRISPR CCATTAGGCTGGTGATGAGG AGG (reversed) Intergenic
No off target data available for this crispr