ID: 909988288

View in Genome Browser
Species Human (GRCh38)
Location 1:82189582-82189604
Sequence AGCCCATTAGGCTGGTGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909988288_909988293 3 Left 909988288 1:82189582-82189604 CCTCATCACCAGCCTAATGGGCT No data
Right 909988293 1:82189608-82189630 TGGCATTTACAAGGATGAGAAGG No data
909988288_909988295 10 Left 909988288 1:82189582-82189604 CCTCATCACCAGCCTAATGGGCT No data
Right 909988295 1:82189615-82189637 TACAAGGATGAGAAGGCTTAGGG No data
909988288_909988294 9 Left 909988288 1:82189582-82189604 CCTCATCACCAGCCTAATGGGCT No data
Right 909988294 1:82189614-82189636 TTACAAGGATGAGAAGGCTTAGG No data
909988288_909988292 -6 Left 909988288 1:82189582-82189604 CCTCATCACCAGCCTAATGGGCT No data
Right 909988292 1:82189599-82189621 TGGGCTGATTGGCATTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909988288 Original CRISPR AGCCCATTAGGCTGGTGATG AGG (reversed) Intergenic
No off target data available for this crispr