ID: 909988289

View in Genome Browser
Species Human (GRCh38)
Location 1:82189588-82189610
Sequence CACCAGCCTAATGGGCTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909988282_909988289 -6 Left 909988282 1:82189571-82189593 CCCTCTTCCCTCCTCATCACCAG No data
Right 909988289 1:82189588-82189610 CACCAGCCTAATGGGCTGATTGG No data
909988283_909988289 -7 Left 909988283 1:82189572-82189594 CCTCTTCCCTCCTCATCACCAGC No data
Right 909988289 1:82189588-82189610 CACCAGCCTAATGGGCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909988289 Original CRISPR CACCAGCCTAATGGGCTGAT TGG Intergenic
No off target data available for this crispr