ID: 909988291

View in Genome Browser
Species Human (GRCh38)
Location 1:82189594-82189616
Sequence TAAATGCCAATCAGCCCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909988291_909988296 23 Left 909988291 1:82189594-82189616 CCTAATGGGCTGATTGGCATTTA No data
Right 909988296 1:82189640-82189662 CAAGCTTTGACAAATATATTTGG No data
909988291_909988294 -3 Left 909988291 1:82189594-82189616 CCTAATGGGCTGATTGGCATTTA No data
Right 909988294 1:82189614-82189636 TTACAAGGATGAGAAGGCTTAGG No data
909988291_909988295 -2 Left 909988291 1:82189594-82189616 CCTAATGGGCTGATTGGCATTTA No data
Right 909988295 1:82189615-82189637 TACAAGGATGAGAAGGCTTAGGG No data
909988291_909988293 -9 Left 909988291 1:82189594-82189616 CCTAATGGGCTGATTGGCATTTA No data
Right 909988293 1:82189608-82189630 TGGCATTTACAAGGATGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909988291 Original CRISPR TAAATGCCAATCAGCCCATT AGG (reversed) Intergenic
No off target data available for this crispr