ID: 909988292

View in Genome Browser
Species Human (GRCh38)
Location 1:82189599-82189621
Sequence TGGGCTGATTGGCATTTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909988284_909988292 -2 Left 909988284 1:82189578-82189600 CCCTCCTCATCACCAGCCTAATG No data
Right 909988292 1:82189599-82189621 TGGGCTGATTGGCATTTACAAGG No data
909988288_909988292 -6 Left 909988288 1:82189582-82189604 CCTCATCACCAGCCTAATGGGCT No data
Right 909988292 1:82189599-82189621 TGGGCTGATTGGCATTTACAAGG No data
909988285_909988292 -3 Left 909988285 1:82189579-82189601 CCTCCTCATCACCAGCCTAATGG No data
Right 909988292 1:82189599-82189621 TGGGCTGATTGGCATTTACAAGG No data
909988283_909988292 4 Left 909988283 1:82189572-82189594 CCTCTTCCCTCCTCATCACCAGC No data
Right 909988292 1:82189599-82189621 TGGGCTGATTGGCATTTACAAGG No data
909988282_909988292 5 Left 909988282 1:82189571-82189593 CCCTCTTCCCTCCTCATCACCAG No data
Right 909988292 1:82189599-82189621 TGGGCTGATTGGCATTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909988292 Original CRISPR TGGGCTGATTGGCATTTACA AGG Intergenic
No off target data available for this crispr