ID: 909988293

View in Genome Browser
Species Human (GRCh38)
Location 1:82189608-82189630
Sequence TGGCATTTACAAGGATGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909988284_909988293 7 Left 909988284 1:82189578-82189600 CCCTCCTCATCACCAGCCTAATG No data
Right 909988293 1:82189608-82189630 TGGCATTTACAAGGATGAGAAGG No data
909988282_909988293 14 Left 909988282 1:82189571-82189593 CCCTCTTCCCTCCTCATCACCAG No data
Right 909988293 1:82189608-82189630 TGGCATTTACAAGGATGAGAAGG No data
909988288_909988293 3 Left 909988288 1:82189582-82189604 CCTCATCACCAGCCTAATGGGCT No data
Right 909988293 1:82189608-82189630 TGGCATTTACAAGGATGAGAAGG No data
909988285_909988293 6 Left 909988285 1:82189579-82189601 CCTCCTCATCACCAGCCTAATGG No data
Right 909988293 1:82189608-82189630 TGGCATTTACAAGGATGAGAAGG No data
909988290_909988293 -5 Left 909988290 1:82189590-82189612 CCAGCCTAATGGGCTGATTGGCA No data
Right 909988293 1:82189608-82189630 TGGCATTTACAAGGATGAGAAGG No data
909988291_909988293 -9 Left 909988291 1:82189594-82189616 CCTAATGGGCTGATTGGCATTTA No data
Right 909988293 1:82189608-82189630 TGGCATTTACAAGGATGAGAAGG No data
909988283_909988293 13 Left 909988283 1:82189572-82189594 CCTCTTCCCTCCTCATCACCAGC No data
Right 909988293 1:82189608-82189630 TGGCATTTACAAGGATGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909988293 Original CRISPR TGGCATTTACAAGGATGAGA AGG Intergenic
No off target data available for this crispr