ID: 909991484 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:82227864-82227886 |
| Sequence | TTAAGACTGGGTTATGGACA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 909991484_909991488 | -2 | Left | 909991484 | 1:82227864-82227886 | CCTTGTCCATAACCCAGTCTTAA | No data | ||
| Right | 909991488 | 1:82227885-82227907 | AATTCCAAGTCAGCCTGCCAAGG | No data | ||||
| 909991484_909991492 | 15 | Left | 909991484 | 1:82227864-82227886 | CCTTGTCCATAACCCAGTCTTAA | No data | ||
| Right | 909991492 | 1:82227902-82227924 | CCAAGGCATTTCATTGCCAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 909991484 | Original CRISPR | TTAAGACTGGGTTATGGACA AGG (reversed) | Intergenic | ||