ID: 909991487

View in Genome Browser
Species Human (GRCh38)
Location 1:82227877-82227899
Sequence GGCTGACTTGGAATTAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909991487_909991492 2 Left 909991487 1:82227877-82227899 CCAGTCTTAATTCCAAGTCAGCC No data
Right 909991492 1:82227902-82227924 CCAAGGCATTTCATTGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909991487 Original CRISPR GGCTGACTTGGAATTAAGAC TGG (reversed) Intergenic
No off target data available for this crispr