ID: 909991492

View in Genome Browser
Species Human (GRCh38)
Location 1:82227902-82227924
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909991489_909991492 -10 Left 909991489 1:82227889-82227911 CCAAGTCAGCCTGCCAAGGCATT No data
Right 909991492 1:82227902-82227924 CCAAGGCATTTCATTGCCAAAGG No data
909991485_909991492 9 Left 909991485 1:82227870-82227892 CCATAACCCAGTCTTAATTCCAA No data
Right 909991492 1:82227902-82227924 CCAAGGCATTTCATTGCCAAAGG No data
909991486_909991492 3 Left 909991486 1:82227876-82227898 CCCAGTCTTAATTCCAAGTCAGC No data
Right 909991492 1:82227902-82227924 CCAAGGCATTTCATTGCCAAAGG No data
909991487_909991492 2 Left 909991487 1:82227877-82227899 CCAGTCTTAATTCCAAGTCAGCC No data
Right 909991492 1:82227902-82227924 CCAAGGCATTTCATTGCCAAAGG No data
909991484_909991492 15 Left 909991484 1:82227864-82227886 CCTTGTCCATAACCCAGTCTTAA No data
Right 909991492 1:82227902-82227924 CCAAGGCATTTCATTGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type