ID: 909992460

View in Genome Browser
Species Human (GRCh38)
Location 1:82239954-82239976
Sequence GCCGACTGGAGCCACAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909992454_909992460 15 Left 909992454 1:82239916-82239938 CCGTCTGGTCTTGCTGGCAGCAA No data
Right 909992460 1:82239954-82239976 GCCGACTGGAGCCACAGTGATGG No data
909992451_909992460 26 Left 909992451 1:82239905-82239927 CCTGGTCCAAACCGTCTGGTCTT No data
Right 909992460 1:82239954-82239976 GCCGACTGGAGCCACAGTGATGG No data
909992453_909992460 20 Left 909992453 1:82239911-82239933 CCAAACCGTCTGGTCTTGCTGGC No data
Right 909992460 1:82239954-82239976 GCCGACTGGAGCCACAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909992460 Original CRISPR GCCGACTGGAGCCACAGTGA TGG Intergenic
No off target data available for this crispr