ID: 909992680

View in Genome Browser
Species Human (GRCh38)
Location 1:82242029-82242051
Sequence CATGAAGCTTAGAAGCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909992680_909992687 23 Left 909992680 1:82242029-82242051 CCATCTTGCTTCTAAGCTTCATG No data
Right 909992687 1:82242075-82242097 TAGGCTAAGCTAATTTAGGGAGG No data
909992680_909992683 4 Left 909992680 1:82242029-82242051 CCATCTTGCTTCTAAGCTTCATG No data
Right 909992683 1:82242056-82242078 CCTTGTTCAATCCTGGAGATAGG No data
909992680_909992686 20 Left 909992680 1:82242029-82242051 CCATCTTGCTTCTAAGCTTCATG No data
Right 909992686 1:82242072-82242094 AGATAGGCTAAGCTAATTTAGGG No data
909992680_909992681 -3 Left 909992680 1:82242029-82242051 CCATCTTGCTTCTAAGCTTCATG No data
Right 909992681 1:82242049-82242071 ATGCTGTCCTTGTTCAATCCTGG No data
909992680_909992685 19 Left 909992680 1:82242029-82242051 CCATCTTGCTTCTAAGCTTCATG No data
Right 909992685 1:82242071-82242093 GAGATAGGCTAAGCTAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909992680 Original CRISPR CATGAAGCTTAGAAGCAAGA TGG (reversed) Intergenic
No off target data available for this crispr