ID: 909992681

View in Genome Browser
Species Human (GRCh38)
Location 1:82242049-82242071
Sequence ATGCTGTCCTTGTTCAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909992680_909992681 -3 Left 909992680 1:82242029-82242051 CCATCTTGCTTCTAAGCTTCATG No data
Right 909992681 1:82242049-82242071 ATGCTGTCCTTGTTCAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909992681 Original CRISPR ATGCTGTCCTTGTTCAATCC TGG Intergenic
No off target data available for this crispr