ID: 909999207

View in Genome Browser
Species Human (GRCh38)
Location 1:82321911-82321933
Sequence GATTCATTAGTCTGGATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909999202_909999207 21 Left 909999202 1:82321867-82321889 CCATTTGGCAAAGTCAACATCCA No data
Right 909999207 1:82321911-82321933 GATTCATTAGTCTGGATCCCTGG No data
909999201_909999207 26 Left 909999201 1:82321862-82321884 CCTCTCCATTTGGCAAAGTCAAC No data
Right 909999207 1:82321911-82321933 GATTCATTAGTCTGGATCCCTGG No data
909999203_909999207 1 Left 909999203 1:82321887-82321909 CCATGTTCAAATGTCCAATACCA No data
Right 909999207 1:82321911-82321933 GATTCATTAGTCTGGATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909999207 Original CRISPR GATTCATTAGTCTGGATCCC TGG Intergenic
No off target data available for this crispr