ID: 910005109

View in Genome Browser
Species Human (GRCh38)
Location 1:82386965-82386987
Sequence GTGTGCACACAGTCATCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910005109_910005116 28 Left 910005109 1:82386965-82386987 CCCTGAGATGACTGTGTGCACAC No data
Right 910005116 1:82387016-82387038 GTTGACATTTTATTTTACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910005109 Original CRISPR GTGTGCACACAGTCATCTCA GGG (reversed) Intergenic
No off target data available for this crispr