ID: 910005116

View in Genome Browser
Species Human (GRCh38)
Location 1:82387016-82387038
Sequence GTTGACATTTTATTTTACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910005113_910005116 2 Left 910005113 1:82386991-82387013 CCCTCCTTCTGTGAGCTGTGACT No data
Right 910005116 1:82387016-82387038 GTTGACATTTTATTTTACTATGG No data
910005111_910005116 4 Left 910005111 1:82386989-82387011 CCCCCTCCTTCTGTGAGCTGTGA No data
Right 910005116 1:82387016-82387038 GTTGACATTTTATTTTACTATGG No data
910005114_910005116 1 Left 910005114 1:82386992-82387014 CCTCCTTCTGTGAGCTGTGACTA No data
Right 910005116 1:82387016-82387038 GTTGACATTTTATTTTACTATGG No data
910005112_910005116 3 Left 910005112 1:82386990-82387012 CCCCTCCTTCTGTGAGCTGTGAC No data
Right 910005116 1:82387016-82387038 GTTGACATTTTATTTTACTATGG No data
910005110_910005116 27 Left 910005110 1:82386966-82386988 CCTGAGATGACTGTGTGCACACG No data
Right 910005116 1:82387016-82387038 GTTGACATTTTATTTTACTATGG No data
910005115_910005116 -2 Left 910005115 1:82386995-82387017 CCTTCTGTGAGCTGTGACTATGT No data
Right 910005116 1:82387016-82387038 GTTGACATTTTATTTTACTATGG No data
910005109_910005116 28 Left 910005109 1:82386965-82386987 CCCTGAGATGACTGTGTGCACAC No data
Right 910005116 1:82387016-82387038 GTTGACATTTTATTTTACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910005116 Original CRISPR GTTGACATTTTATTTTACTA TGG Intergenic
No off target data available for this crispr