ID: 910007098

View in Genome Browser
Species Human (GRCh38)
Location 1:82411132-82411154
Sequence TTGTTGTTTATATATCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910007095_910007098 7 Left 910007095 1:82411102-82411124 CCAGCCTCCAGAATAGTGAGCAA 0: 3
1: 43
2: 570
3: 3094
4: 6132
Right 910007098 1:82411132-82411154 TTGTTGTTTATATATCACCCAGG No data
910007093_910007098 23 Left 910007093 1:82411086-82411108 CCTGATTTTTTATTTCCCAGCCT No data
Right 910007098 1:82411132-82411154 TTGTTGTTTATATATCACCCAGG No data
910007094_910007098 8 Left 910007094 1:82411101-82411123 CCCAGCCTCCAGAATAGTGAGCA No data
Right 910007098 1:82411132-82411154 TTGTTGTTTATATATCACCCAGG No data
910007092_910007098 24 Left 910007092 1:82411085-82411107 CCCTGATTTTTTATTTCCCAGCC No data
Right 910007098 1:82411132-82411154 TTGTTGTTTATATATCACCCAGG No data
910007097_910007098 0 Left 910007097 1:82411109-82411131 CCAGAATAGTGAGCAAAAAATTT No data
Right 910007098 1:82411132-82411154 TTGTTGTTTATATATCACCCAGG No data
910007096_910007098 3 Left 910007096 1:82411106-82411128 CCTCCAGAATAGTGAGCAAAAAA No data
Right 910007098 1:82411132-82411154 TTGTTGTTTATATATCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910007098 Original CRISPR TTGTTGTTTATATATCACCC AGG Intergenic
No off target data available for this crispr