ID: 910008267

View in Genome Browser
Species Human (GRCh38)
Location 1:82427303-82427325
Sequence CAATGACCATAAATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910008267_910008270 3 Left 910008267 1:82427303-82427325 CCTTCCTCCATTTATGGTCATTG No data
Right 910008270 1:82427329-82427351 TTATGTCCTTGCCTACCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910008267 Original CRISPR CAATGACCATAAATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr