ID: 910012872

View in Genome Browser
Species Human (GRCh38)
Location 1:82486965-82486987
Sequence AGAAAGAGCCATAGAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910012872_910012879 -7 Left 910012872 1:82486965-82486987 CCAGTTTTTCTATGGCTCTTTCT No data
Right 910012879 1:82486981-82487003 TCTTTCTTAAGAGAAGGGGGGGG No data
910012872_910012880 -6 Left 910012872 1:82486965-82486987 CCAGTTTTTCTATGGCTCTTTCT No data
Right 910012880 1:82486982-82487004 CTTTCTTAAGAGAAGGGGGGGGG No data
910012872_910012878 -8 Left 910012872 1:82486965-82486987 CCAGTTTTTCTATGGCTCTTTCT No data
Right 910012878 1:82486980-82487002 CTCTTTCTTAAGAGAAGGGGGGG No data
910012872_910012876 -10 Left 910012872 1:82486965-82486987 CCAGTTTTTCTATGGCTCTTTCT No data
Right 910012876 1:82486978-82487000 GGCTCTTTCTTAAGAGAAGGGGG No data
910012872_910012877 -9 Left 910012872 1:82486965-82486987 CCAGTTTTTCTATGGCTCTTTCT No data
Right 910012877 1:82486979-82487001 GCTCTTTCTTAAGAGAAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910012872 Original CRISPR AGAAAGAGCCATAGAAAAAC TGG (reversed) Intergenic
No off target data available for this crispr