ID: 910012880

View in Genome Browser
Species Human (GRCh38)
Location 1:82486982-82487004
Sequence CTTTCTTAAGAGAAGGGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910012872_910012880 -6 Left 910012872 1:82486965-82486987 CCAGTTTTTCTATGGCTCTTTCT No data
Right 910012880 1:82486982-82487004 CTTTCTTAAGAGAAGGGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910012880 Original CRISPR CTTTCTTAAGAGAAGGGGGG GGG Intergenic
No off target data available for this crispr