ID: 910015988

View in Genome Browser
Species Human (GRCh38)
Location 1:82524624-82524646
Sequence CATAGCTGTAACTCACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910015988_910015989 -7 Left 910015988 1:82524624-82524646 CCAGCTTGTGAGTTACAGCTATG No data
Right 910015989 1:82524640-82524662 AGCTATGTGAAAATCACTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910015988 Original CRISPR CATAGCTGTAACTCACAAGC TGG (reversed) Intergenic
No off target data available for this crispr