ID: 910017555

View in Genome Browser
Species Human (GRCh38)
Location 1:82546350-82546372
Sequence GAGGAGCATCAGAAAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910017547_910017555 12 Left 910017547 1:82546315-82546337 CCTTACCCTCTAGTTTCCTGGTT No data
Right 910017555 1:82546350-82546372 GAGGAGCATCAGAAAGAGGGAGG No data
910017551_910017555 -4 Left 910017551 1:82546331-82546353 CCTGGTTGGTTAAGCAAATGAGG No data
Right 910017555 1:82546350-82546372 GAGGAGCATCAGAAAGAGGGAGG No data
910017544_910017555 22 Left 910017544 1:82546305-82546327 CCATGAACTCCCTTACCCTCTAG No data
Right 910017555 1:82546350-82546372 GAGGAGCATCAGAAAGAGGGAGG No data
910017549_910017555 7 Left 910017549 1:82546320-82546342 CCCTCTAGTTTCCTGGTTGGTTA No data
Right 910017555 1:82546350-82546372 GAGGAGCATCAGAAAGAGGGAGG No data
910017550_910017555 6 Left 910017550 1:82546321-82546343 CCTCTAGTTTCCTGGTTGGTTAA No data
Right 910017555 1:82546350-82546372 GAGGAGCATCAGAAAGAGGGAGG No data
910017546_910017555 13 Left 910017546 1:82546314-82546336 CCCTTACCCTCTAGTTTCCTGGT No data
Right 910017555 1:82546350-82546372 GAGGAGCATCAGAAAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910017555 Original CRISPR GAGGAGCATCAGAAAGAGGG AGG Intergenic
No off target data available for this crispr