ID: 910026688

View in Genome Browser
Species Human (GRCh38)
Location 1:82663208-82663230
Sequence CAGGCTAAATACAGTGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910026688_910026691 -3 Left 910026688 1:82663208-82663230 CCACCTGCACTGTATTTAGCCTG No data
Right 910026691 1:82663228-82663250 CTGTGATCCCACAGAAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910026688 Original CRISPR CAGGCTAAATACAGTGCAGG TGG (reversed) Intergenic
No off target data available for this crispr