ID: 910026691

View in Genome Browser
Species Human (GRCh38)
Location 1:82663228-82663250
Sequence CTGTGATCCCACAGAAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910026685_910026691 27 Left 910026685 1:82663178-82663200 CCAATGACATTAAGGCAGTCCAA No data
Right 910026691 1:82663228-82663250 CTGTGATCCCACAGAAAACCAGG No data
910026687_910026691 8 Left 910026687 1:82663197-82663219 CCAATGGATTTCCACCTGCACTG No data
Right 910026691 1:82663228-82663250 CTGTGATCCCACAGAAAACCAGG No data
910026688_910026691 -3 Left 910026688 1:82663208-82663230 CCACCTGCACTGTATTTAGCCTG No data
Right 910026691 1:82663228-82663250 CTGTGATCCCACAGAAAACCAGG No data
910026689_910026691 -6 Left 910026689 1:82663211-82663233 CCTGCACTGTATTTAGCCTGTGA No data
Right 910026691 1:82663228-82663250 CTGTGATCCCACAGAAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910026691 Original CRISPR CTGTGATCCCACAGAAAACC AGG Intergenic
No off target data available for this crispr