ID: 910028917

View in Genome Browser
Species Human (GRCh38)
Location 1:82691961-82691983
Sequence CTGTGTACGGACAGGAATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910028917_910028922 14 Left 910028917 1:82691961-82691983 CCTAGATTCCTGTCCGTACACAG No data
Right 910028922 1:82691998-82692020 GCTCCAAACTTACAAATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910028917 Original CRISPR CTGTGTACGGACAGGAATCT AGG (reversed) Intergenic
No off target data available for this crispr