ID: 910031106 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:82724812-82724834 |
Sequence | CTGTGGCAGTGTAACAAAGT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
910031102_910031106 | 1 | Left | 910031102 | 1:82724788-82724810 | CCAAATTTTTGTCTCTTAATTAC | No data | ||
Right | 910031106 | 1:82724812-82724834 | CTGTGGCAGTGTAACAAAGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
910031106 | Original CRISPR | CTGTGGCAGTGTAACAAAGT TGG | Intergenic | ||
No off target data available for this crispr |