ID: 910031106

View in Genome Browser
Species Human (GRCh38)
Location 1:82724812-82724834
Sequence CTGTGGCAGTGTAACAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910031102_910031106 1 Left 910031102 1:82724788-82724810 CCAAATTTTTGTCTCTTAATTAC No data
Right 910031106 1:82724812-82724834 CTGTGGCAGTGTAACAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910031106 Original CRISPR CTGTGGCAGTGTAACAAAGT TGG Intergenic
No off target data available for this crispr